Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26 5 proteins of Duck Enteritis Virus" doc

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR. Quantification of Vgf- and pro-SAAS-derived pep-tides in endocrine tissues and the brain, and their regulation by diet and ... underwent a one-week training period wherein they were intro-duced to the apparatus and handled by the operator daily. Testing was conducted during the last 4 hours of the day portion of the light ... Acad Sci USA 2006; 103(39): 1 458 4-1 458 9. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic...

Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx

... Sense Antisenseβ-actin 5& apos;-AGGCCAACCGTGAAAAGATG-3' 5& apos;-ACCAGAGGCATAC AGGGACAA-3'IFN-γ 5& apos;-GAAAGACAACCAGGCCATCAG-3' 5& apos;-TCATGAATGCATCCTTTTTTGC-3'IL-4 5& apos;-CCACGGAGAACGAG ... 5& apos;-CCACGGAGAACGAG CTCATC-3' 5& apos;-GAGAACCCCAGACTTGTTCTTCA-3'IL-17 5& apos;-GGGAAGTTGGACCACCACAT-3' 5& apos;-TTCTCCACCCGGAAA GTGAA-3'Arthritis Research & Therapy Vol ... Immunopharmacology2000, 49:2 85- 294.3. Tanaka K, Kawasaki H, Kurata K, Aikawa Y, Tsukamoto Y, Inaba T:T-614, a novel antirheumatic drug, inhibits both the activity and induction of cyclooxygenase-2 (COX-2)...

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... mutation of SDCCAG8 as the cause of a retinal-renal ciliopathy. Nat Genet 2010, 42:840- 850 . 33. Lander ES, Botstein D: Homozygosity mapping: a way to map human recessive traits with the DNA of...

Báo cáo y học: "Anti-class a scavenger receptor autoantibodies from systemic lupus erythematosus patients impair phagocytic clearance of apoptotic cells by macrophages in vitro" doc

... and prepared the manuscript. C-YS worked on the clinical data presentation and participated in the statistical analysis. C-DY was responsible for the main experimentaldesign, data interpretation, ... receptors appear to be new targetantigens in SLE. MARCO is a trimeric membrane proteincontaining a short N-terminal intracellular domain, a transmembrane domain, and a large extracellular domaincomposed ... of a spacer domain, a long collagenousdomain, and a C-terminal scavenger receptor cysteine-rich (SRCR) domain. SRCR plays a major role in the ligand-binding function of MARCO [9,10]. The bindingof...

Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

... Hirofumi Akari8, Yoshio Koyanagi9, Jun Fujita3 and Takashi Uchiyama1Address: 1Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, ... Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606- 850 7, Japan, 7Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 56 9-11 25, Japan, ... 8Laboratory of Disease Control, Tukuba Primate Research Center, National Institute of Biomedical Innovation, Hachimandai-1, Tsukuba, Ibaraki 3 05- 0843, Japan and 9Laboratory of Viral Pathgenesis,...

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... alkalinization, hy-dration and rasburicase at 0.10 mg/kg for 3 -5 days maintains the same efficacy. [ 25] Anyway, we may have favourable issues by changing the dose of ras-buricase, according ... structural analogous of hypoxanthine, inhibitor of xanthine oxi-dase, the last enzyme involved in uric acid synthesis pathway. It catalyzes the conversion of hypoxanyhine into xanthine and this ... monophosphate (GMP), the purinic nucleotides useful for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid. Hypoxanthine and guanine...

Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

... DNAsugars and distamycin atoms are observed.Rings A and B make an angle of 8.6 °,ringsBandC21.1 °, and ring C makes an angle of 15. 7 ° with the terminalamidinium group.Quantum chemical analysis ... inaccuratepositioning of the interacting groups. The contact area of the distamycin amidinium end wasinvestigated by evaluating the hydrogen positions and interaction energy terms for the interactions ... close contacts between the terminal distamycin atoms and guanine amino groupsare inevitable. The detailed nature of several of these inter-actions was further investigated by ab initio quantumchemical...

Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf

... 11 also give a new inequality in the whole plane.By applying the method of 10, 11 and using the way of real and complex analysis, the main objective of this paper is to give a new Hilbert-type ... to the reverse of 3.1.2 Journal of Inequalities and ApplicationsAll of the above inequalities are built in the quarter plane. Yang 10 built a new Hilbert-typeintegral inequality in the ... MathematicalAnalysis and Applications, vol. 3 25, no. 1, pp. 52 9 54 1, 2007.8 D. M. Xin, A Hilbert-type integral inequality with a homogeneous kernel o f zero degree,”Mathematical Theory and Applications,...

Báo cáo hóa học: " Research Article A Novel Secure Localization Approach in Wireless Sensor Networks" pot

... behavior of the attack sources does not change dramatically. 5. 4. Probability of Identify ing All Attacked Locators. To ana-lyze the probability of identifying all the attacked locators for the B-TSCD ... can see that as the ρlincreases, the probability of successful localization also increases. This ismainly because the increase of ρlenlarges the probability of detecting at least two attacked ... H(ts).An example of the distance-consistent spooking attack isshown in Figure 1 (a) . As two colluding attackers A 1 and A 2can communicate with each other via an attack link,locatorsL4, L 5 and...

Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx

... period-1)from the input signal. This step helps in removing the repeatsthat due to single base repeat pattern, for instance, repeat likeAAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of ... Pro-cessing Magazine, vol. 18, no. 4, pp. 8–20, 2001.[16] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and R. Ramaswamy, “Prediction of probable genes by Fourieranalysis of genomic ... 2007, Article ID 4 359 6, 7 pagesdoi:10.1 155 /2007/4 359 6Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA SequencesRavi Gupta, Divya Sarthi,...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam