Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26 5 proteins of Duck Enteritis Virus" doc

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR. Quantification of Vgf- and pro-SAAS-derived pep- tides in endocrine tissues and the brain, and their regulation by diet and ... underwent a one-week training period wherein they were intro- duced to the apparatus and handled by the operator daily. Testing was conducted during the last 4 hours of...

Ngày tải lên: 03/11/2012, 10:52

8 503 0
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx

Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx

... Sense Antisense β-actin 5& apos;-AGGCCAACCGTGAAAAGATG-3' 5& apos;-ACCAGAGGCATAC AGGGACAA-3' IFN-γ 5& apos;-GAAAGACAACCAGGCCATCAG-3' 5& apos;-TCATGAATGCATCCTTTTTTGC-3' IL-4 5& apos;-CCACGGAGAACGAG ... 5& apos;-CCACGGAGAACGAG CTCATC-3' 5& apos;-GAGAACCCCAGACTTGTTCTTCA-3' IL-17 5& apos;-GGGAAGTTGGACCACCACAT-3' 5& apos;-TTCTCCACCCGGAAA GTGAA-3' Art...

Ngày tải lên: 09/08/2014, 13:22

11 375 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... features include dextrocardia, L-transposition of the great arteries, abdominal situs inversus, bilateral (a) t TCTCCC...

Ngày tải lên: 09/08/2014, 23:20

36 447 0
Báo cáo y học: "Anti-class a scavenger receptor autoantibodies from systemic lupus erythematosus patients impair phagocytic clearance of apoptotic cells by macrophages in vitro" doc

Báo cáo y học: "Anti-class a scavenger receptor autoantibodies from systemic lupus erythematosus patients impair phagocytic clearance of apoptotic cells by macrophages in vitro" doc

... and prepared the manuscript. C-YS worked on the clinical data presentation and participated in the statistical analysis. C-DY was responsible for the main experimental design, data interpretation, ... receptors appear to be new target antigens in SLE. MARCO is a trimeric membrane protein containing a short N-terminal intracellular domain, a transmembrane domain, and a...

Ngày tải lên: 12/08/2014, 15:22

9 398 0
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

... Hirofumi Akari 8 , Yoshio Koyanagi 9 , Jun Fujita 3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, ... Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606- 850 7, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 56 9-...

Ngày tải lên: 13/08/2014, 05:21

12 692 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... alkalinization, hy- dration and rasburicase at 0.10 mg/kg for 3 -5 days maintains the same efficacy. [ 25] Anyway, we may have favourable issues by changing the dose of ras- buricase, according ... structural analogous of hypoxanthine, inhibitor of xanthine oxi- dase, the last enzyme involved in uric acid synthesis pathway. It catalyzes the conversion of hypoxanyhine...

Ngày tải lên: 31/10/2012, 14:59

11 716 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx

... DNA sugars and distamycin atoms are observed. Rings A and B make an angle of 8.6 °,ringsBandC 21.1 °, and ring C makes an angle of 15. 7 ° with the terminal amidinium group. Quantum chemical analysis ... inaccurate positioning of the interacting groups. The contact area of the distamycin amidinium end was investigated by evaluating the hydrogen positions and intera...

Ngày tải lên: 24/03/2014, 04:21

10 411 0
Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf

Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf

... 11 also give a new inequality in the whole plane. By applying the method of 10, 11 and using the way of real and complex analysis, the main objective of this paper is to give a new Hilbert-type ... to the reverse of 3.1. 2 Journal of Inequalities and Applications All of the above inequalities are built in the quarter plane. Yang 10 built a new...

Ngày tải lên: 21/06/2014, 05:20

11 386 0
Báo cáo hóa học: " Research Article A Novel Secure Localization Approach in Wireless Sensor Networks" pot

Báo cáo hóa học: " Research Article A Novel Secure Localization Approach in Wireless Sensor Networks" pot

... behavior of the attack sources does not change dramatically. 5. 4. Probability of Identify ing All Attacked Locators. To ana- lyze the probability of identifying all the attacked locators for the B-TSCD ... can see that as the ρ l increases, the probability of successful localization also increases. This is mainly because the increase of ρ l enlarges the probability...

Ngày tải lên: 21/06/2014, 11:20

12 397 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx

Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx

... period-1) from the input signal. This step helps in removing the repeats that due to single base repeat pattern, for instance, repeat like AAAAA in DNA sequence ACGACAAAAACAACG because the repeat pattern of ... Pro- cessing Magazine, vol. 18, no. 4, pp. 8–20, 2001. [16] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and R. Ramaswamy, “Prediction of probable gen...

Ngày tải lên: 22/06/2014, 19:20

7 206 0
Từ khóa:
w