Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt
Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt
... this article as: Chakrabarti et al.: Host gene expression profiling in influenza A virus-infected lung epithelial (A5 49) cells: a comparative analysis between highly pathogenic and modified H5N1 ... was done using gene annotation files and raw data were extracted into MS EXCEL. Data Analysis Data was analyzed using GENOWIZ Microarray and Pathway...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: " Global gene expression patterns in the post-pneumonectomy lung of adult mice" ppt
... 0.05) between PNY and SHAM, and between 3 day and 7 day time points. Results Microarray analysis and validation Microarray data was collected from pooled lung samples (n = 8) at four time points ... 1 day, 3 day and 7 day) during post-pneumonectomy lung regeneration from both PNY and SHAM animals. As mentioned in the meth- ods section, the data obtained from these micr...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Microarray gene expression profiling of osteoarthritic bone suggests altered bone remodelling, WNT and transforming growth factor-β/bone morphogenic protein signalling" pot
... TCACCAATGGGGAGATACAG GTCTTGGGAATTCAGCTCCT PTEN (NM_000314 ) AAGACAAAGCCAACCGATAC GAAGTTGAACTGCTAGCCTC RUNX2 (NM_004348 ) TGATGACACTGCCACCTCTG GGGATGAAATGCTTGGGAAC S10 0A4 (NM_002961 ) GTCAGAACTAAAGGAGCTGC ... scores above 4. Gene function and pathway analyses were carried out by searching the National Centre for Biotechnology Information database [52] and by using various analysis pro...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt
... processing and presentation, etc. The microarray experimental plan and data analysis in this study are in accordance with MIAME guidelines [36]. The microarray data presented in this manuscript has ... Gene array analysis comparison between rat collagen-induced arthritis and human rheumatoid arthritis. Scandinavian journal of immunology 2008, 68:43-57. 70. Teixeira VH,...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Differential gene expression patterns in cyclooxygenase-1 and cyclooxygenase-2 deficient mouse brain" ppsx
... determined by microarray and quantitative PCR (Q- PCR) analysis. These genes, namely hydroxyacyl coenzyme -A dehydrogenase (HADH2), acetyl coenzyme -A acetyltransferase (ACAT1) and ATP citrate lyase, ... enzyme catalysis. Adv Exp Med Biol 1999, 466:133-143. 16. Yang SY, He XY, Schulz H: 3-Hydroxyacyl-CoA dehydrogenase and short chain 3-hydroxyacyl-CoA dehydrogenase in human health...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo y học: "Differential gene expression in HIV/SIV-associated and spontaneous lymphomas"
... 5’-GGAAGTGTTAGGGTTTGGTTTCT-3’ 60 capn4 5’-CCACAAGCTTTTGTTCTCTCAGTA-3’ 5’-CACAGGTACAGGGGAGAGGTTAC-3’ 60 pub 5’-TACTGACCGAGTGCTGAGACTACT-3’ 5’-GCAATTTGCCATATCAATAAAGAA-3’ 60 Northern blot analysis ... named 16S RNA most probably relates to the humanin gene [17], since its transcript contains poly (A) . According to our data (Tab. 5) a- myb was overexpressed in all AIDS-rela...
Ngày tải lên: 02/11/2012, 11:08
Báo cáo y học: "Differential gene expression in pristane-induced arthritis susceptible DA versus resistant E3 rats" potx
... the pathways in which the genes are operating. Conclusion We showed that a rather simple microarray analysis is useful in identifying interesting pathways and candidate genes that operate early in ... (Qiagen, Valencia, CA, USA). The purity and concentration of RNA was determined by A 260/280 analysis and the RNA quality was analyzed by agarose gel electrophoresis. Affymet...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... GTCAGCCAACTCGTCACAGTCC OPN Sense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582 Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618 Antisense CCTGTCTCCACACACGAACTG IGF-II Sense GAGGAGTGCTGTTTCCGCAG ... Data are expressed as parametric mean ± standard devi- ation (open diamond) and non-parametric median (closed diamond) and quartile (dash) range. COL 1A, col...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Angiogenesis gene expression in murine endothelial cells during post-pneumonectomy lung growth" pptx
... events. RNA and quantitative PCR In al l RNA isolatio ns, the total RN A quality w as assessed by using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA integrity numbers (RIN) ... angiogenesis genes in lung endothelial cells. After left pneumonectomy, the remaining right lung was examined on days 3, 6, 14 and 21days after surgery and compared to both no...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: "Smad gene expression in pulmonary fibroblasts: indications for defective ECM repair in COPD" ppsx
... gene expression. TGFβ, TNF, and CSE cause differential downregulation of decorin gene expression in COPD patients, at least partially via the Smad pathway. Our findings may explain why only a ... hand can affect this pathway by inhibiting phosphorylation of Smad2 and Smad3 and inducing ubiquination of their receptors. Additionally, Smad7 can induce TGFβ-production by fibrobla...
Ngày tải lên: 12/08/2014, 14:20