Báo cáo y học: "Upregulation of a novel eukaryotic translation initiation factor 5A (eIF5A) in dengue 2 virus-infected mosquito cells" pot
Báo cáo y học: "Upregulation of a novel eukaryotic translation initiation factor 5A (eIF5A) in dengue 2 virus-infected mosquito cells" pot
... attenuation of the virus. Virology 20 01, 28 9: 129 -136. doi:10.1186/1743- 422 X-7 -21 4 Cite this article as: Shih et al.: Upregulation of a novel eukaryotic translation initiation factor 5A (eIF 5A) in dengue ... hypusine- containing protein eukaryotic initiation factor 5A in activated human T lymphocytes. Proc Nat Acad Sci USA 1994, 91:10 829 -10833. 25...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: " Identification of a novel resistance (E40F) and compensatory (K43E) substitution in HIV-1 reverse transcriptase" doc
... containing M41L+T21 5Y or the M41L+T21 5Y+ E40F plasmid, the primers HXB2-43E (5' ACA GAG ATG GAA GAG GAA GGG AAA A- 3', nucle- otides 26 64 26 88), 43E-RT (5' ACA GAG CTG GAA GAG GAA ... M41L +21 5Y refer- ence plasmid primers 40F-RT1 (5' GAA ATT TGT ACA TAG CTG GAA AAG G-3', nucleotides 26 55 26 79), 40F-RT2 5' GAA ATT TGT ACA TTG CTG GAA AAG G-3', nu...
Ngày tải lên: 13/08/2014, 06:20
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx
... Bombyx mori; detoxication; insect; UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role in the detoxication and elimination of a ... characte rization of BmUGT1 activity without the interference of EGT, a closely related enzyme [28 ]. The expression of the recombinant protein was analysed by metabolic labelli...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo y học: "Demonstration of a novel technique to quantitatively assess inflammatory mediators and cells in rat knee joints" pps
... sample contained the same amount of IL1β that was initially infused. 2. 3.4 Cytokine levels in normal and FCA-injected joints Basal samples from ipsilateral and contralateral joints of 10 normal ... cell recruitment, adhesion and activation. In addition, prostaglandins are secreted into the synovial cavity and are involved in perpetuation of local inflammation, vasodilatation and...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc
... sense UL26c GGATCCATGCAATCTACTATGACG GTCGACTCAACATCTATTACACATCA 10 42- 2 124 1083 F1 GGATCCATGCAATCTACTATGACG GTCGACTTACAGCTGCCCTCCCTGGAC 10 42- 1347 306 F2 GGATCCATGTATGGACAGCCTGTTTAT GTCGACTTAAGCTAATGGTCCAGTAGA 129 4-1731 ... 438 F3 GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681 -21 24 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT CTTTGGTCGACTTAATCTCCAGATTCGACGGC 129 4-1455 1 62 F2 -2...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: " Identification of a novel betaherpesvirus in Mus musculus" docx
... analysis was performed using the same primers as in the initial analysis. DNA of organs and tissue supernatants was extracted using the QiAamp tissue kit according to the manufacturer's instructions ... Long-dis- tance (LD) PCR using the TaKaRa-Ex PCR system (Takara Bio inc., Otsu, Japan) according to the manufacturer's instructions. An amplification product of approximately 3...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "Characterization of a novel and spontaneous mouse model of inflammatory arthritis" pptx
... of 38 AR × DBA1 1 0 of 20 0 of 21 2 0 of 13 1 of 20 AR × C3H 1 1 of 16 0 of 24 2 0 of 15 0 of 25 a Mice were followed for an average of 120 postnatal days and a minimum of 90 postnatal days, except ... Yamazaki K, Hosono N, Myouzen K, Tsunoda T, Kamatani N, Furuichi T, Ikegawa S, Ohmura K, Mimori T, Matsuda F, Iwamoto T, Momohara S, Yamanaka H, Yamada R, Ku...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo y học: "Characterization of a novel and spontaneous mouse model of inflammatory arthritis" doc
... salts All DMARDs can slow progression of joint (injectable), hydroxychloroquine, le unomide, damage as well as gradually decrease pain and methotrexate, penicillamine, sulfasalazine swelling ... 10:4 025 -4031. 6. Horai R, Saijo S, Tanioka H, Nakae S, Sudo K, Okahara A, Ikuse T, Asano M, Iwakura Y: Development of chronic in ammatory arthropathy resembling rheumatoid arthritis in...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... Tax2B protein. Tax207 Tax 224 Tax263 Tax2 32 Tax250 Tax300 Tax154 Tax1 Tax2B 356 PBM 20 7 22 4 26 3 23 2 25 0 300 A) 154 p100 p 52 Tax Tubulin EGFP Tax300 Tax263 Tax2B Tax2 32 Tax250 Tax154 Tax207 Tax 224 Tax1 Infection ... ̕ ̕̕ ̕ 22 5 -22 7 23 1 -23 2 Leucine zipper-like PBM 22 5 -23 2 22 5 -22 7 Tax300 Tax1 23 1 -23 2 Control 22 5 -23 2 22 5 -22 7 Tax300 Tax1 23 1 -23 2...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf
... laboratory strains BaL, NL4.3 and HE were added at a final concentration of respectively 25 0, 100 and 20 0 pg/ml p24 Ag for all cell lines mentioned above. The viral input of the clinical iso- lates was ... out in 24 -well plates already containing compounds and chemokines at varying con- centrations (1/5 dilutions). SCH-C and AMD3100 were evaluated as single agents or as a mixt...
Ngày tải lên: 13/08/2014, 13:20