báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx

báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx

báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx

... walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design Elsbeth F Taminiau-Bloem 1* , Florence J van Zuuren 2† , Margot A Koeneman 1† , ... Journal of Cancer 2005, 41:1679-1709. doi:10.1186/1477-7525-8-69 Cite this article as: Taminiau-Bloem et al.: A ‘short walk’ is longer before rad...

Ngày tải lên: 12/08/2014, 01:21

12 230 0
Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx

Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx

... supported by Novartis Pharmaceuticals and Aventis Pharmaceuticals, respectively. L. M. C. was funded by a grant from Novartis Pharmaceuticals. References 1. Pahl, H.L. (1999) Activators and target genes ... epithelium is the primary site of contact with airborne allergens, irritants, pathogens and other proinflammatory agents that trigger exacerbation in airway diseases [15]. This...

Ngày tải lên: 07/03/2014, 15:20

7 379 0
Báo cáo khoa học: "Conventionally-fractionated image-guided intensity modulated radiotherapy (IG-IMRT): a safe and effective treatment for cancer spinal metastasis" pptx

Báo cáo khoa học: "Conventionally-fractionated image-guided intensity modulated radiotherapy (IG-IMRT): a safe and effective treatment for cancer spinal metastasis" pptx

... in AP axis, respectively; and the green line was the actual DVH of the cord). (a: the simulated and actual DVHs of the cord and b: the simulated and actual maximum dose of 5% volume of the ... previously treated cancer patients with confirmed diagnosis of ≤ 2 spinal metastases and no other distant metastasis were recruited in this study. The basic and clinical ch...

Ngày tải lên: 09/08/2014, 09:22

10 436 0
Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx

Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx

... generally found in the ovary and adrenal gland. In fishes, the adrenal homolog is not as compact as the adrenal gland found in mammals. In fishes, adrenal tissue exists as aminergic chromaffin and ... Mississauga, Canada), the zebra- fish fabp6 transcripts were amplified by PCR from total RNA extracted from various tissues using the forward pri- mer, 5¢-TAGGCAAAGAGAGCCACATGGAGA-3¢,...

Ngày tải lên: 07/03/2014, 06:20

10 379 0
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... ACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTACACAAG GACTTAAGGCATTTAGACAACAGCTTCGGAAG AATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAA TCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTG TCTAAATGCCTTAAGTCCTTGTGTAAGGGACG TATC, ... 5¢-GCGAGG ACCAAGGGGATTCTGGAGCTGAACAAGGTGC AATTGTTGTACGAACAGGTGTGCCAGTCCT...

Ngày tải lên: 30/03/2014, 15:20

13 440 0
Báo cáo khoa học: "Intra-arterial chemoradiation for T3-4 oral cavity cancer: Treatment outcomes in comparison to oropharyngeal and hypopharyngeal carcinoma" pot

Báo cáo khoa học: "Intra-arterial chemoradiation for T3-4 oral cavity cancer: Treatment outcomes in comparison to oropharyngeal and hypopharyngeal carcinoma" pot

... this analysis, to test the hypothesis that oral cavity carcinoma treated with RADPLAT has similar outcome to oropharyngeal and hypopharyngeal carci- noma. All patients in this subset analysis ... that employ the intra-arterial approach remains to be seen. The advantage of the intra-arterial technique is based on the blood supply to the oral cavity. Tumors arising in this site...

Ngày tải lên: 09/08/2014, 07:21

6 380 0
Báo cáo khoa học: " Peripheral blood complete remission after splenic irradiation in Mantle-Cell Lymphoma with 11q22-23 deletion and ATM inactivation" pot

Báo cáo khoa học: " Peripheral blood complete remission after splenic irradiation in Mantle-Cell Lymphoma with 11q22-23 deletion and ATM inactivation" pot

... Giovanni Battista, Torino, Italy and 2 Medical Oncology, Ospedale Alba-Bra-ASL 18, Alba-Bra, Italy Email: Andrea Riccardo Filippi* - andrea.filippi@unito.it; Pierfrancesco Franco - pier4377@yahoo.it; ... detecting radiation-induced DNA damage (expecially Double Strand Breaks) and it is known to be affected by germline mutations (truncation) in patients with Ataxia Teleangiectasia, an...

Ngày tải lên: 09/08/2014, 10:21

3 205 0
báo cáo khoa học:" An instrument to assess quality of life in relation to nutrition: item generation, item reduction and initial validation" potx

báo cáo khoa học:" An instrument to assess quality of life in relation to nutrition: item generation, item reduction and initial validation" potx

... instrument, conceived the study, contributed to collecting all but the reliability data and analyzed data and wrote the first draft of this article. FS contributed to collecting all but the reliability data and analyzed ... literature search and reviewed the final draft of the article. CM approved the study protocol, supplied the data for the reliability study...

Ngày tải lên: 12/08/2014, 01:21

13 263 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... mid-way along the chain. Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant ... days. (C) Heart, kidney, lung and spleen RNA from each of three animals was analysed for Cyp4x1 RNA, and a 5-day exposure of the autoradiograph is shown; – and + represent y...

Ngày tải lên: 19/02/2014, 07:20

12 466 0
Báo cáo khoa học: Kinetics of violaxanthin de-epoxidation by violaxanthin de-epoxidase, a xanthophyll cycle enzyme, is regulated by membrane fluidity in model lipid bilayers pptx

Báo cáo khoa học: Kinetics of violaxanthin de-epoxidation by violaxanthin de-epoxidase, a xanthophyll cycle enzyme, is regulated by membrane fluidity in model lipid bilayers pptx

... probability that violaxanthin remains violaxanthin; AA, probability that anthera- xanthin remains antheraxanthin; ZZ, probability that zeaxanthin remains zeaxanthin; S VA , the constant rate ... of violaxanthin into antheraxanthin (V A) with a probability VA and antheraxanthin into zeaxanthin (A Z) with a probability AZ. It is known from experimental data that these two steps reach...

Ngày tải lên: 08/03/2014, 10:20

10 419 0
w