báo cáo khoa học:" Pain in castration-resistant prostate cancer with bone metastases: a qualitative study" pptx

... C, Zecca E, Martini C, Campa T, Fagnoni E, Bagnasco M, et al: Comparison of numerical and verbal rating scales to measure pain exacerbations in patients with chronic cancer pain. Health Qual Life Outcomes ... guidelines for cancer pain man- agement, pain is often under treated in cancer patients [13,14], which may in part be because of the difficulties in assessing pai...

Ngày tải lên: 12/08/2014, 00:20

... 30,000 deaths each year from prostate cancer [1]. External beam radiation therapy (EBRT) and/or brachytherapy are main- stays of local therapy. Low dose rate (LDR) brachytherapy, with permanently implanted ... consecutive rises in PSA over the last 9 months) has been used in many large prostate cancer trials. After failure, patients may con- sider salvage therapy, including addi...

Ngày tải lên: 09/08/2014, 10:21

... worse than with attenuated words only). Our function tag- ging task is easier thanfindinggrammaticalrelations as we tag a headword of a chunk as e.g. a subject in isolation whereas grammatical relation ... (pre-classified) training instances as points in a multi-dimensional feature space, and stores them as such in an instance base in mem- ory (rather than performing some abst...

Ngày tải lên: 08/03/2014, 07:20

... indicate that mitochondrial matrix proteins undergo oxidative and glycoxidative modifications. These damaged proteins accumulate with aging, in parallel with a large decrease in Lon protease activity. Materials ... eight main bands are stained, with two intense signals of 70 and 50 kDa, while the bands at 60 and 150 kDa vanished. With oxyblot (Fig. 4C), antibodies stained carbony...

Ngày tải lên: 20/02/2014, 11:20

... general programs as well as to databases. Current Prolog systems, because they were designed with programming not databases in mind, are not capable of accommodating really large databases. ... practical computational formalisms. The outcome of this "top-down" approach, as reallsed in the language Prolog, has a great deal in common with the relational approach t...

Ngày tải lên: 21/02/2014, 20:20

... medium without any previous treatment (trace a) . Mitochondria incubated with rBAX without calcium (trace b). Mitochondria incubated with rBAX and calcium (trace c). A a b, c rBAX BAX M β CD –– + A B VDAC 0 0.04 0.06 0.08 0.10 0.12 500 1000 ... mitochon- dria incubated with 150 n M rBAX without calcium; trace e, mitochondria incubated with 150 nM rBAX and calcium. (B) Dw in rBA...

Ngày tải lên: 07/03/2014, 05:20

... position within a sentence with a 'gap' elsewbere. The latter analysis will be recognized as a vari- ant of a standard Govermnent-Binding treatment, in which a tensed verb in a main clause ... German and Dutch, there are two positions in a sentence where tensed verbs may appear: in second position of a main clause, and in final position of a subo...

Ngày tải lên: 24/03/2014, 02:20

... 5¢-GTAA CCATGGGTGAACAGGAAGA A- 3¢;BCCP-rev,5¢- GGATCCTTAAACGTTTGTGTC TATAAG-3¢; BCCP K117L, 5¢-GAAGCTCTACTG GTTATGAAC-3¢. DNA was isolated from agarose using a QIAquickÒ Gel Extraction Kit, and plasmid ... sites are indicated by underlining and mutagenic changes are shown in bold). BPL-for, 5¢-TTCTTAA CCATGG GCTTCAAAAACCTGAT-CTGG-3¢;BPL-rev,5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BC...

Ngày tải lên: 31/03/2014, 07:20

...

Ngày tải lên: 07/08/2014, 18:21

... d A mangium. La date optimale d’inoculation après la germination des plantes a été déterminée. L’ARA et la croissance des plantes n’ont pas été modifiées lorsque l’inoculation ... acetylene-ethylene assay for N2- fixation: laboratory and field estimation. Plant Physiol 43, 1185-1207 Lakshminarayana K, Narula N, Tauro P (1988) A simple technique to o...

Ngày tải lên: 09/08/2014, 03:24