báo cáo khoa học:" Pain in castration-resistant prostate cancer with bone metastases: a qualitative study" pptx

báo cáo khoa học:" Pain in castration-resistant prostate cancer with bone metastases: a qualitative study" pptx

báo cáo khoa học:" Pain in castration-resistant prostate cancer with bone metastases: a qualitative study" pptx

... C, Zecca E, Martini C, Campa T, Fagnoni E, Bagnasco M, et al: Comparison of numerical and verbal rating scales to measure pain exacerbations in patients with chronic cancer pain. Health Qual Life Outcomes ... guidelines for cancer pain man- agement, pain is often under treated in cancer patients [13,14], which may in part be because of the difficulties in assessing pai...

Ngày tải lên: 12/08/2014, 00:20

11 291 0
Báo cáo khoa học: " Early observed transient prostate-specific antigen elevations on a pilot study of external beam radiation therapy and fractionated MRI guided High Dose Rate brachytherapy boost" doc

Báo cáo khoa học: " Early observed transient prostate-specific antigen elevations on a pilot study of external beam radiation therapy and fractionated MRI guided High Dose Rate brachytherapy boost" doc

... 30,000 deaths each year from prostate cancer [1]. External beam radiation therapy (EBRT) and/or brachytherapy are main- stays of local therapy. Low dose rate (LDR) brachytherapy, with permanently implanted ... consecutive rises in PSA over the last 9 months) has been used in many large prostate cancer trials. After failure, patients may con- sider salvage therapy, including addi...

Ngày tải lên: 09/08/2014, 10:21

5 383 0
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx

... worse than with attenuated words only). Our function tag- ging task is easier thanfindinggrammaticalrelations as we tag a headword of a chunk as e.g. a subject in isolation whereas grammatical relation ... (pre-classified) training instances as points in a multi-dimensional feature space, and stores them as such in an instance base in mem- ory (rather than performing some abst...

Ngày tải lên: 08/03/2014, 07:20

8 658 0
Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc

Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc

... indicate that mitochondrial matrix proteins undergo oxidative and glycoxidative modifications. These damaged proteins accumulate with aging, in parallel with a large decrease in Lon protease activity. Materials ... eight main bands are stained, with two intense signals of 70 and 50 kDa, while the bands at 60 and 150 kDa vanished. With oxyblot (Fig. 4C), antibodies stained carbony...

Ngày tải lên: 20/02/2014, 11:20

8 413 0
Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc

Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc

... general programs as well as to databases. Current Prolog systems, because they were designed with programming not databases in mind, are not capable of accommodating really large databases. ... practical computational formalisms. The outcome of this "top-down" approach, as reallsed in the language Prolog, has a great deal in common with the relational approach t...

Ngày tải lên: 21/02/2014, 20:20

4 446 0
Báo cáo khoa học: Changes in specific lipids regulate BAX-induced mitochondrial permeability transition pptx

Báo cáo khoa học: Changes in specific lipids regulate BAX-induced mitochondrial permeability transition pptx

... medium without any previous treatment (trace a) . Mitochondria incubated with rBAX without calcium (trace b). Mitochondria incubated with rBAX and calcium (trace c). A a b, c rBAX BAX M β CD –– + A B VDAC 0 0.04 0.06 0.08 0.10 0.12 500 1000 ... mitochon- dria incubated with 150 n M rBAX without calcium; trace e, mitochondria incubated with 150 nM rBAX and calcium. (B) Dw in rBA...

Ngày tải lên: 07/03/2014, 05:20

11 447 0
Báo cáo khoa học: "Asymmetry in Parsing and Generating with Unification Grammars: Case Studies From ELU" pot

Báo cáo khoa học: "Asymmetry in Parsing and Generating with Unification Grammars: Case Studies From ELU" pot

... position within a sentence with a 'gap' elsewbere. The latter analysis will be recognized as a vari- ant of a standard Govermnent-Binding treatment, in which a tensed verb in a main clause ... German and Dutch, there are two positions in a sentence where tensed verbs may appear: in second position of a main clause, and in final position of a subo...

Ngày tải lên: 24/03/2014, 02:20

7 308 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx

Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx

... 5¢-GTAA CCATGGGTGAACAGGAAGA A- 3¢;BCCP-rev,5¢- GGATCCTTAAACGTTTGTGTC TATAAG-3¢; BCCP K117L, 5¢-GAAGCTCTACTG GTTATGAAC-3¢. DNA was isolated from agarose using a QIAquickÒ Gel Extraction Kit, and plasmid ... sites are indicated by underlining and mutagenic changes are shown in bold). BPL-for, 5¢-TTCTTAA CCATGG GCTTCAAAAACCTGAT-CTGG-3¢;BPL-rev,5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BC...

Ngày tải lên: 31/03/2014, 07:20

11 578 0
Báo cáo khoa học: " Nodulation in vitro d’Acacia mangium Willd (Leguminosae) A Galiana" ppt

Báo cáo khoa học: " Nodulation in vitro d’Acacia mangium Willd (Leguminosae) A Galiana" ppt

... d A mangium. La date optimale d’inoculation après la germination des plantes a été déterminée. L’ARA et la croissance des plantes n’ont pas été modifiées lorsque l’inoculation ... acetylene-ethylene assay for N2- fixation: laboratory and field estimation. Plant Physiol 43, 1185-1207 Lakshminarayana K, Narula N, Tauro P (1988) A simple technique to o...

Ngày tải lên: 09/08/2014, 03:24

10 328 0
w