báo cáo khoa học:" The ICF as a common language for rehabilitation goal-setting: comparing client and professional priorities" ppt

... common language for rehabilitation goal-setting: comparing client and professional priorities Michal Harty * , Maryka Griesel and Aletia van der Merwe Abstract Background: Joint rehabilitation goals ... 1993, 47(4):298-301. doi:10.1186/1477-7525-9-87 Cite this article as: Harty et al.: The ICF as a common language for rehabilitation goal-setting: comp...

Ngày tải lên: 12/08/2014, 00:20

... that the agr feature of the DAG associated with the VP be the same as (unified with) the agr of the V. Thus, the VP's agr feature will have as its value the same node as the V's agr, ... V's agr, and hence the same values for the person and number features. Similarly, by virtue of the unification associated with the S rule, the NP will...

Ngày tải lên: 24/03/2014, 01:21

... authors, the actual standard karyotype description by GTG- and RBG-banding for the chicken, established by the International Committee for the Standardization of the Avian ... classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and usually classi...

Ngày tải lên: 09/08/2014, 18:21

... Aeron 1 , Sidharth Jain 1 , Nikhil Narayan 1 , Rahul Bamal 1 , Yashwant Kumar 1 , S Srinivas 1 , Sunita Saxena 2 Abstract Introduction: Elephantiasis as a result of chronic lymphedema is characterized ... Access Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature Chintamani 1* , JP Singh 1 , Megha Tandon 1 , Rohan Khandel...

Ngày tải lên: 11/08/2014, 02:22

... developed as an al~ma~ive to the aandard tyntac~ formalisms that are ,,_~'~ in theoretical ~,.ll,/~s of languaSe. They are a. rwac~ve because they may pin,vide just the asFects of ... that a TAG is incomplete ms an account of the structure of a natural language, e.g. a TAG grammar wW contain ~th an active and a passive form of the same verbal sutx:ategur...

Ngày tải lên: 24/03/2014, 02:20

... an L- and an Oh-layer. The Of-layer has become tangled and lami- nated. The pH has decreased by half a unit. The translocation of fulvic acids has increased and the first ... and humification has decreased and the humus form has changed from mull to moder. The translo- cation of fulvic acids has increased and first signs of podz...

Ngày tải lên: 08/08/2014, 23:22

... sol- ids – oral preparation stage) and oral final stages [5]. In case of liquid swallowing, during the oral initial stage the water intake takes place and a labial seal occurs. The oral final stage occurs ... induced dysphagia. Conclusion: With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for opti...

Ngày tải lên: 11/08/2014, 20:20

... in canine mammary gland cancer Renata A Sobral 1 , Suzana T Honda 1 , Maria Lucia H Katayama 1 , Helena Brentani 2 , M Mitzi Brentani 1 , Diogo FC Patrão 2 and Maria Aparecida AK Folgueira* 1 Address: ... chemotherapy for breast cancer is associated with the same survival benefit as adjuvant chemotherapy and offers the advantage of an increased likelihood of breast conservati...

Ngày tải lên: 12/08/2014, 18:22

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) an...

Ngày tải lên: 19/02/2014, 17:20

... base in the 5¢…CCT/AGG…3¢ sequence. Materials and methods Chemicals and enzymes AdoMet and AdoHcy were from Sigma (USA). [CH 3 – 3 H]AdoMet (77 CiÆmmol )1 ) was from Amersham (USA). [ 32 P]ATP[cP] ... several times and, as a result, methylates all target cytosine residues for 30 min. The observed level of methy- lation of duplex IIIm was low. There was a linear increase of...

Ngày tải lên: 07/03/2014, 15:20