báo cáo khoa học:" Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial" pot
... citation purposes) Head & Face Medicine Open Access Research Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, ... was 34.10 in the precancer group as compared to 53.97 in cancer group and 33.65 in the nor- mal group. The mean age in precancer an...
Ngày tải lên: 11/08/2014, 23:22
... human basophil activation and histamine release and Iikura et al. [18] reported that immobilized secretory IgA on Sepharose beads was capa- ble of inducing basophil degranulation and histamine release. ... (65.5%). Dermatophagoides pteronyssinus (Dpt) was the causative allergen in 62, Dermatophagoides farinae (Df) in 58, cat hair dander in 23 and dog hair dander in 9 patients...
Ngày tải lên: 13/08/2014, 13:22
... fibrinogen- containing ICs that characterise a subset of anti-CCP+ RA patients and may contribute to synovitis in RA. Materials and methods Human samples All RA and control plasma and joint samples ... chromatography was applied to fractionate plasma derived from an RA patient with fibrinogen-containing circulating ICs, an RA patient with circu- lating ICs but not fibrinogen-con...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo khoa học: "Circulating immune parameters predicting the progression from hospital-acquired pneumonia to septic shock in surgical patients" doc
... IL-8 and IL-6, might be explained as an exaggerated and imbalanced pro- and anti-inflammatory immune response after surgery. In general, a clinical complication of HAP is the dissemination of bacteria ... there was no significant increase in the levels of C- reactive protein, lactate and platelets (Table 3). Immune modulating mediators and clinical parameters at the...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx
... generally found in the ovary and adrenal gland. In fishes, the adrenal homolog is not as compact as the adrenal gland found in mammals. In fishes, adrenal tissue exists as aminergic chromaffin and inter-regnal ... intracellular function(s). In vitro binding assays revealed a surprisingly low affinity of recombinant- derived human FABP6 and rat Fabp6 for long-chain fatty ac...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf
... 5¢-AAA GAATTCCTGTGGCAGGGGACCAGT GG; 708R: 5¢-AAA GAATTCGGGCTGGAGGAGGGG CGTTG; 632R: 5¢-AAA GAATTCCGGGGTGTGGAAG GTACTCA; 572R: 5¢-AAA GAATTCCTCCTGGAAGC TGACAGG; 341R: 5¢-AAA GAATTCGAGCAGGAGG TAGTAAAT; the ... 5¢-GATACGTCTCTC ACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTAC...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: "Rib fracture after stereotactic radiotherapy on follow-up thin-section computed tomography in 177 primary lung cancer patients" potx
... S .A carried out clinical data collection, dosimetry calculation and revision of clinical data. T.K, E.S and L.T carried out collection of CT data and clinical data. K.K, T.K, K.M, M .A, R.S and ... Osteosclerosis was defined as an area of increased attenuation comparable to cortex in the medulla of rib. The time at which each finding first appeared after the completion...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo khoa học: "Enhanced immune response with foot and mouth disease virus VP1 and interleukin-1 fusion genes" potx
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Circulating β-endorphin, adrenocorticotrophic hormone and cortisol levels of stallions before and after short road transport: stress effect of different distances" pps
... 5 3:1 21-129. 27. Hydbring E, Nyman S, Dahlborn K: Changes in plasma cortisol, plasma β-endorphin, heart rate, haematocrit and plasma protein concentration in horses during restraint and use of a naso-gastric ... Edited by: Grandin T. Wallingford, Oxon, CABI; 199 3:2 33-252. 21. Oikawa M, Takagi S, Anzai R, Yoshikawa H, Yoshikawa T: Pathology of equine respiratory disease occur...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo khoa học: "Circulating inflammatory mediators and organ dysfunction after cardiovascular surgery with cardiopulmonary bypass: a prospective observational study" pot
... 1 Kinetics of inflammatory mediators at anesthesia induction and after cardiopulmonary bypassKinetics of inflammatory mediators at anesthesia induction and after cardiopulmonary bypass. (a) Macrophage ... MF and DASAV conducted immunoassays and data acquisition and drafted the manuscript. MLFM was involved in patient recruitment and the acquisition of data. LAAC and HCCFN unde...
Ngày tải lên: 12/08/2014, 23:22