báo cáo khoa học:" Biological and biomechanical evaluation of interface reaction at conical screw-type implants" doc

... number not for citation purposes)Head & Face MedicineOpen AccessResearch Biological and biomechanical evaluation of interface reaction at conical screw-type implantsAndre Büchter*1, ... after 28 days of osseointegration.SEM of implantation sites in tibia specimens at different mag-nificationsFigure 5SEM of implantation sites in tibia specimens at different mag-nifications. Bone-implant ... understand-ing of osseointegration. The understanding of the com-plex bone/implant interactions at different levels willprovide an opportunity to evaluate and produce implantswith specific and...

Báo cáo khoa học: "Quantitative and Qualitative Evaluation of Darpa Communicator Spoken Dialogue Systems" pdf

... user’s travel plans both at the beginning of the dialogue and also afterQuantitative and Qualitative Evaluation of Darpa CommunicatorSpoken Dialogue SystemsMarilyn A. Walker AT& amp;T Labs – Research180 ... dialogue parser, and retrain our models of user satisfaction. We ﬁnd that many of the dia-logue act metrics are signiﬁcant predictors of usersatisfaction, and that the model ﬁt for user sat-isfaction ... generation and had only a limited number of ways of saying thesame content, it was possible to achieve 100% ac-curacy with a parser that tags utterances automat-ically from a database of patterns...

báo cáo khoa học: "Phenotype and functional evaluation of ex vivo generated antigen-specific immune effector cells with potential for therapeutic applications" pps

... cross-pres-entation requires further investigation.To assess differentiation and maturation status of the exvivo generated T cells, we applied multi-color flow cytom-etry to detect differentiation and ... proliferation and replicative senescence associ-ated with down-regulation of anti-apoptotic protein Bcl-2 and Bcl-xL, and decreased telomere length. [33,34,41]Modification of antigen presentation ... CD45RA+),differentiation (CD27 and CD28) and migration (CCR7)markers of T cells in addition to CD4, CD8 and IFN-γ (orCD137). We found that there was a trend of increasedearly-differentiated Tcm and Tem...

báo cáo khoa học: "Profiling and quantitative evaluation of three Nickel-Coated magnetic matrices for purification of recombinant proteins: helpful hints for the optimized nanomagnetisable matrix preparation" pps

... purifi-cation of His-tagged proteins and presents a major lim-itation for broad application of such materials. I n thisregard, optimization and evaluation of commerciallyavailable matrices is mandatory, ... conception and design. SZ has participated in data analysis and AHZ has involved inmethodology design, interpretation of data, critical revision of themanuscript and final approval of the version ... residues. JChromatogr B Analyt Technol Biomed Life Sci 1987, 411:177-184.4. Cao H, Lin R: Quantitative Evaluation of His-Tag Purification and Immunoprecipitation of Tristetraprolin and Its Mutant...

Báo cáo khoa học: Synthesis and structural characterization of a mimetic membrane-anchored prion protein doc

... thereconstitution of PrP–GPIm into liposomes. PrP–GPImwas mixed with the appropriate amount of OG and soni-cated for 15 min in a water bath at room temperature.Liposomes were added to yield ﬁnal concentrations ... involves the use of 70% (v ⁄ v) eth-anol in water, 10-fold molar excess of GPIm and incu-bation at room temperature for 2 h. The use of buffer(MES or MOPS) even at low concentrations (2 mm)resulted ... (mM)Absorbance at 350 nmABFig. 5. Solubilization of liposomes by the detergent OG at 20 °C.Liposomes formed by extrusion at pH 7 (s) and at pH 5 (d) weretitrated with OG and the turbidity...

Báo cáo khoa học: Biochemical and molecular characterization of puriﬁed chicken pancreatic phospholipase A2 docx

... volume of 20 lL for 5 min at room temperature and 60 min at 42 °C. The cDNA–RNA heteroduplex was thendenaturated at 70 °C for 15 min and cooled on ice.Cloning of the mature PLA2geneAmpliﬁcation ... compilation ª 2009 FEBS35 cycles of denaturating at 94 °C for 1 min, primer anneal-ing at 55 °C for 1 min, and extension at 72 °C for 3 min.The PCR product (500 kbp) was isolated and ligated ... Effect of Ca2+concentration on ChPLA2activity. Enzymeactivity was measured at increasing concentrations of Ca2+, usingPC as substrate, at pH 9.5 and at 37 °C in the presence of 1 mMNaTDC....

Báo cáo khoa học: " Managerial and environmental determinants of clinical mastitis in Danish dairy herd" doc

... interpretation of data and revising the manuscript. LA participated in the statisticaldesign and analysis, and revising the manuscript. JFA and HH made substantial contribution to conception and revising ... estimate the association of managementvariables with herd mastitis rate.Results: Three latent factors (quality of labor, region of Denmark and claw trimming, and quality of outdoor holding ... environmental factors and to assess the rele-vance of these herd-specific indicators to mastitisincidence rate.MethodsDataThe data from the Danish Cattle Data Base and a manage-ment questionnaire...

Báo cáo khoa học: " Biochemical and developmental characterization of carbonic anhydrase II from chicken erythrocytes" doc

... CA-II of approximately15% above that of non-pregnant female Beagles and 30%above that of male Beagles [ 12]. Mean concentrations of CA-I and CA-II in racehorses were 1.70 and 0.94 mg/g of Hb, ... intracellularpH of the shell gland fell to a mean value of 6.53 duringthe first 8 h of calcification and then rose to 6.97 duringthe latter part of shell formation. The formation of theeggshell of the ... levels of CA-II in erythrocytesKondo et al. [22] reported that the concentration of CA-II in human ery throcytes was approximately 3.2 mg/g of Hb and that of CA-I was approximately 14 mg/g of Hb.Although...

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE ... the presence and absence of ATP. In the presence of ATP, puriﬁedwild-type Vps4 is catalytically active and will hydrolyseadded ATP. Thus interactions that are regulated byVps4p ATPase activity ... had unique features.The interaction of Bro1 with Vps4p is regulated byATP binding rather than hydrolysis, and interaction of Did2p with Vps4p is regulated by neither ATPbinding nor ATP hydrolysis....

Báo cáo khoa học: "Beyond Projectivity: Multilingual Evaluation of Constraints and Measures on Non-Projective Structures" doc

... we only provide counts of edges of positive,nonpositive, and negative level types. For lack of space, we do not present full distributions of leveltypes nor of level signatures.Positive level ... levelsignatures of non-projective edges, combining lev-els of nodes with the partitioning of gaps of non-projective edges into components. We derive a for-mal property of these signatures that links ... reviewthe constraint of projectivity and deﬁne related no-tions necessary in Section 4, where we deﬁne and discuss all evaluated constraints and measures; Sec-tion 5 describes our data and experimental...

Xem thêm