báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

... The authors report a new case of hard palate squamous cell carcinoma in a FA patient. The clinical his- tory and localization of the tumour make this case unique. Case report The patient, a 27-year-old ... carcinoma of the hard palate in a Fanconi Anaemia patient. The atypical clinical manifestation rendered the diagnosis more difficult. This c...

Ngày tải lên: 11/08/2014, 23:22

5 245 0
Tài liệu Báo cáo khóa học: Active-site residues and amino acid specificity of the bacterial 4¢-phosphopantothenoylcysteine synthetase CoaB pptx

Tài liệu Báo cáo khóa học: Active-site residues and amino acid specificity of the bacterial 4¢-phosphopantothenoylcysteine synthetase CoaB pptx

... increases the detectable amounts of PPC when wt His-CoaB is used, whereas there is a slight decrease for His-CoaB A2 75T (data not shown). As has been determined above, the residue adjacent to Ala275, ... Asn59, Ala179, Ala180 and Asp183 from one monomer and Arg55¢ from the adjacent monomer corres- pond to E. coli CoaB residues Asn210, Ala275, Ala276, Asp279 and Arg206. A model...

Ngày tải lên: 19/02/2014, 12:20

10 491 0
báo cáo khoa học: " An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae" pptx

báo cáo khoa học: " An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae" pptx

... analys- ing the standard curve of a cDNA serial dilution of that gene. The expression was normalized to Fragaria × ana- nassa actin and Prunus cerasus actin with Fragaria vesca stage 1 flower bud and ... of Strawberry plants and Generation of 35S: FaMYB10 Fragaria × ananassa plants Strawberry plants of Fragaria × ananassa and Fragaria vesca were grown under controlled conditio...

Ngày tải lên: 12/08/2014, 03:21

17 333 0
Báo cáo khoa học: Mutant recombinant serpins as highly specific inhibitors of human kallikrein 14 ppt

Báo cáo khoa học: Mutant recombinant serpins as highly specific inhibitors of human kallikrein 14 ppt

... -CCATGTTTCTAGAGGCTCTGCAGC GTGCTATCCCGCCTGAGGTCAAGTT-3¢; rAAT G9 ,5¢- CCATGTTTCTAGAG ACCGTTGACTACGCTATCCCG CCTGAGGTCAAGTT-3¢, rACT E8 ,5¢-TACCGCGGTCA AAATC CTGCAGCGTGCTATCCTGGT GGAGACGCG TGA-3¢ and rACT G9 ,5¢-TACCGCGGTCAAAACCGTTG ACTACGCTGCTCTGGTGGAGACGCGTGA-3¢. ... trypsin and plasma kallikrein, Suc-Ala-Ala- Pro-Phe-AMC for chymotrypsin, Z-Gly-Gly-Arg-AMC for thrombin, MeOSuc-Ala-Ala-Pro-Val...

Ngày tải lên: 30/03/2014, 11:20

10 424 0
Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc

Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc

... similar cata- lytic activities [7,33], we assume that k cat a1 =K a1 $ k cat a2 =K a2 for illustrative purposes. Notably, Src association with the plasma membrane can lead to a significant increase in ... interactions that lead to an autoin- hibited conformation [2]. SFKs can associate with the plasma membrane and intracellular membranes, such as the endoplasmic retic- ulum,...

Ngày tải lên: 18/02/2014, 11:20

17 513 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... importance of WASP–WIP interaction in mammalian cells is sup- ported by the observation that the vast majority of the disease-causing missense mutations in human WASP map to the N-terminal WH1 ... novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. Vajjhala 4 and Alan L. Munn 1,3,4,6 * 1 Institute of M...

Ngày tải lên: 18/02/2014, 16:20

23 680 0
Tài liệu Báo cáo khoa học: Gas6 and protein S Vitamin K-dependent ligands for the Axl receptor tyrosine kinase subfamily pptx

Tài liệu Báo cáo khoa học: Gas6 and protein S Vitamin K-dependent ligands for the Axl receptor tyrosine kinase subfamily pptx

... in the deg- radation of clotting factors Va and VIIIa [5]. Gas6 has the same domain organization as protein S, namely an N-terminal region containing 11 c-carboxyglutamic acid residues (Gla), a ... increased cell cell adhesion may be at least as significant as activation of intracellular signal- ling. It will be of interest to directly compare Axl, Sky and Mer with each oth...

Ngày tải lên: 19/02/2014, 05:20

14 602 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... 5¢-CT GCCTTGCTCCACACCTG-3¢; F1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig. 2A) . Luciferase promoter assay Human genomic DNA was isolated from ... raised against KLK11 was the same size as that of the translational product by isoform 2 mRNA (Fig. 4B). The product by isoform 1 mRNA was smaller than the isoform 2 product....

Ngày tải lên: 19/02/2014, 06:20

9 544 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA sequences of the x-5 gliadin gene ... sequencer (Applied Biosystems, Foster City, CA, USA). Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TA...

Ngày tải lên: 20/02/2014, 01:20

8 484 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

... a- amy- lase, maltotetraohydrolase, maltopentaohydrolase, malto- genic a- amylase, CGTase, and the acarviose transferase (which has, however, been assigned the same EC number as CGTase). While the ... (principally CGTases) was not readily defined, because maltogenic a- amylase, acarviose transferase, and the archaeal CGTase clustered together at a distance from the main CGTase...

Ngày tải lên: 08/03/2014, 08:20

11 616 0
w