báo cáo khoa học:" Head & Face Medicine – a new journal for ''''''''intra-interdisciplinary'''''''' science Why? When? Where?" doc

... purposes) Head & Face Medicine Open Access Editorial Head & Face Medicine – a new journal for 'intra-interdisciplinary' science. Why? When? Where? Thomas Stamm* Address: Poliklinik ... Open Access and open peer review turn a journal like Head & Face Medicine to a cross between a traditional journal and a data stream which ca...

Ngày tải lên: 11/08/2014, 23:22

... units. Caspases and inhibitors Caspase substrates and their inhibitors were purchased from Biomol. Ac-DEVD-AMC is a substrate for caspases 3 and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC ... is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC are tetra peptide substrates representin...

Ngày tải lên: 19/02/2014, 13:20

... start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L-galac- tono-1,4-lactone dehydrogen...

Ngày tải lên: 07/03/2014, 12:20

... For each aligned paragraph pair (i.e. a simple paragraph and one or more normal paragraphs), we then used a dynamic programming approach to find that best global sentence alignment following ... translation. Com- putational Linguistics. Franz Josef Och, Kenji Yamada, Stanford U, Alex Fraser, Daniel Gildea, and Viren Jain. 2004. A smorgasbord of features for statistical machine transl...

Ngày tải lên: 07/03/2014, 22:20

... 274, 2391 6–2 3925. 28 Takei Y, Kadomatsu K, Yuzawa Y, Matsuo S & Muramatsu T (2004) A small interfering RNA targeting vascular endothelial growth factor as cancer therapeu- tics. Cancer Res ... McCarthy J & Rapraeger AC (1996) Pervanadate activation of intracellular kinases leads to tyrosine phosphorylation and shedding of syndecan-1. Biochem J 319, 3 9–4 7. 38 Slimani H, Charn...

Ngày tải lên: 16/03/2014, 18:20

... categorial and phrase structure grammars. In Language and Information ed. Bar-Hillel, Addison- Wesley, pages 9 9–1 15. Yehoshua Bar-Hillel. 1953. A quasi-arithmetic descrip- tion for syntactic description. ... emphasize that the predicate is intransitive and it may have a locative adjunct. Similarly, a T.OBJECT link is added from “kitap” to “okudu˘gum”. Similar labels were added to...

Ngày tải lên: 17/03/2014, 06:20

... with DAGs. S ~ NP VP < VP afr> = <NP agr> VP * V IVP Uther: < VP agr> = < V agr> < eat > =np <agr number> = singular <agr person> = third Arthur: ... <eat> = np <agr number> = singular <agrperson> = third knights: <eat> = v <aqr number> = singular <agr person> = third This grammar (plus lexicon) a...

Ngày tải lên: 24/03/2014, 01:21

... Grammars, or "TAG's', (Josh/, Levy & Takahash/ 1975; Josh/ 1983; Kroch & Josh/ 1965) we~ developed as an al~ma~ive to the aandard tyntac~ formalisms that are ,,_~'~ ... useful than, for example, tramffotmationai generatb,+ grammars or even procedurally oriented AI fogmali-qa~s |of language such as ATN's. The generation researcher's primar...

Ngày tải lên: 24/03/2014, 02:20

... demon- strating a neuroendocrine tumor, the fact that the lesion was solitary, and that an anatomic resection could be per- formed to achieve negative margins. In the last few years some authors have ... tumor, with emphasis on the treatment of liver metastases. Case presentation We evaluated a 45 year-old patient who presented initially with abdominal pain. Abdominal and pelvic CT scan s...

Ngày tải lên: 09/08/2014, 07:21

... 1998, 41:407-13. 14. Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... Osaka city, Osaka 540-0006 Japan. 3 Department of Radiation Oncology, Osaka University Graduate School of Medicine, Yamadaoka 2-2, Suita, 565-0871 Osaka, Japan. 4 Department of M...

Ngày tải lên: 09/08/2014, 09:20