Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx
Báo cáo y học: "CD147 overexpression on synoviocytes in rheumatoid arthritis enhances matrix metalloproteinase production and invasiveness of synoviocytes" pptx
... in the lining and sublining layers of RA synovium, and macrophages acted as the ampli- fier of the pathogenetic cascade in RA via the increase of MMP production by interacting macrophages with ... purposes) zymography assays. ZW performed the statistical analysis. YY performed the RT-PCR. JD carried out the flow cytometry assays. ZC participated in the design of...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Leukocyte numbers and function in subjects eating n-3 enriched foods: selective depression of natural killer cell levels" potx
... are important in immune surveillance, particu- larly against viral infections and cancer [22-24], the cells are also likely to play a role in the pathogenesis of inflammatory diseases as they ... released by adding 50% ethanol and the absorbance was read at 570 nm using a plate reader (Dynatech MR7000, Dynatech Laboratories, Chantilly, VA). The degree of adherence was calc...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
... Tanaka Y, Marusawa H, Seno H, Matsumoto Y, Ueda Y, Kodama Y, Endo Y, Yamauchi J, Matsumoto T, Takaori-Kondo A, et al.: Anti- viral protein APOBEC3G is induced by interferon-alpha stimulation in ... gonorrhea, chlamydial infection and syphilis. Those infections can damage the epithelial barrier and cause microbial translocation leading ulti- mately to inflammation and activation of...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx
... sequelae attributable to VAD. The areas of the vertebral artery vulnerable to injury dur- ing blunt neck trauma are, V2 (inside the transverse foramina) and the V3 (between the C1 and the base of the skull) ... purposes) Journal of Brachial Plexus and Peripheral Nerve Injury Open Access Case report Traumatic vertebral artery dissection in an adult with brachial p...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt
... bp (-240~+50) PAX5β-TF PAX5β-TR CGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTG GGCCAGTGAATTGTAATACGACTCACTATAG GGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC 301 bp (-92~+141) Quantitative MSP primers DAPK-qF DAPK-qR AG(C/T)G(C/T)GGAGTTGGGAGGAGTA CAAAC (A/ G)ACCAATAAAAACCCTACAAAC 121 ... Primer RASSF 1A- TF RASSF 1A- TR CGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTT GGCCAGTGAATTGTAATACGAC...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Medroxyprogesterone improves nocturnal breathing in postmenopausal women with chronic obstructive pulmonary disease" pps
... Although the maximum inspiratory slope was already at baseline within normal postmenopausal range, MPA almost dou- bled the slope. This finding is in line with the thinking that the baseline respiratory ... and interpretation of tcCO 2 data and in the statistical analyses, and drafted the manuscript. KU participated in the analyses and interpretation of tcCO 2 data...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "Impaired urge-to-cough in elderly patients with aspiration pneumonia" doc
... takae_montreal@hotmail.com; Miyako Yamasaki - ymskmyk@idac.tohoku.ac.jp; Takaaki Asamura - t- asamuraum777@silk.plala.or.jp; Masanori Asada - m-asada@idac.tohoku.ac.jp; Kaori Une - unekaori@hotmail.com; Hiroyuki Arai ... Takae Ebihara, Miyako Yamasaki, Takaaki Asamura, Masanori Asada, Kaori Une and Hiroyuki Arai Address: Department of Geriatrics and Gerontology, Institute of Development...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx
... citation purposes) Journal of Medical Case Reports Open Access Case report Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic ... describe a 23-year-old man with an exophytic capillary haemangioblastoma of the optic nerve head that was treated with intravitreal bevacizum...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"
... [20]. The role of medical professionals is a dominant factor in defining, controlling and scoping the work of the allied health professionals [21,22] as extending pharma- cists’ roleinprimarycaremayaffecttheautonomyand control ... medication in the previous year. The majority of them (19%) reported having no consultation with a Chinese medicine practitioner within t...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"
... delivered by student chiropractors in a clinical teaching facility. The W-BQ12 was also used as a tool to assess the validity of the well being component of the MyMOP2 against the validated W-BQ12 instrument ... coordination. BP, AK and MW supervised the student chiropractors in the collection and analysis of data. MJW undertook a further overall statistical anal...
Ngày tải lên: 25/10/2012, 10:06