Báo cáo y học: " Dissemination of Strongyloides stercoralis in a patient with systemic lupus erythematosus after initiation of albendazole: a case report" docx
Báo cáo y học: " Dissemination of Strongyloides stercoralis in a patient with systemic lupus erythematosus after initiation of albendazole: a case report" docx
... improvement after institution of ivermectin. Case presentation A 38-year-old woman emigrated from the Dominican Republic 1 year prior to presentation with complaints of 6 days of abdominal pain and blood-flecked ... and Escherichia coli. After 10 days of ivermectin and consistently negative stool examination for ova and parasites, antiparasitic therapy was discontinued. The...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "CD147 overexpression on synoviocytes in rheumatoid arthritis enhances matrix metalloproteinase production and invasiveness of synoviocytes" pptx
... 5'-ACATCAACGAGGGGGAGACG-3' and 5'-GGCTTCAGACAGGCAGGACA-3' for CD147 (492 bp); and 5'-CTGAACGGGAAGCT CACTGG-3' and 5'- TGAGGTCCACCACCCTGTTG-3' for glyceraldehyde ... the lining and sublining layers of RA synovium, and macrophages acted as the ampli- fier of the pathogenetic cascade in RA via the increase of MMP production by interacting macrophag...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Leukocyte numbers and function in subjects eating n-3 enriched foods: selective depression of natural killer cell levels" potx
... University of South Australia, Australia, Adelaide SA 5000, Australia 4 Discipline of Paediatrics, University of Adelaide, 72 King William Road, North Adelaide SA 5006, Australia Corresponding author: ... treatment of autoimmune and allergic inflammatory conditions [1-4]. Counterbalancing n-6 fatty-acid intake with n-3 fatty acids is important because n-6 fatty acids, such as arachi...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
... Tanaka Y, Marusawa H, Seno H, Matsumoto Y, Ueda Y, Kodama Y, Endo Y, Yamauchi J, Matsumoto T, Takaori-Kondo A, et al.: Anti- viral protein APOBEC3G is induced by interferon-alpha stimulation in ... HIV-1 propagation was seen only at an early time point follow- ing initiation of the co-culture (i.e. 2 days) and was rap- idly lost thereafter is indicative of a modulatory effect...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: "Culture-negative bivalvular endocarditis with myocardial destruction in a patient with systemic lupus erythematosus: a case report." ppsx
... vena cava, dome of the l eft atrium, right atrium, and intra-atrial septum. Valve tissue was sent for pathology and microbiologic analysis. The patient was started on vancomycin and ciprofloxacin. ... participated in the care of the patient and wrote the initial manuscript. BS participated in the care of the patient and edited the manuscript. All authors participated in appr...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx
... T, Karampelas Ioannis, Karydas Georgios, Karabinis Andreas: Unilateral and bilateral vertebral artery dissection following motor vehicle injury – two cases and a mini-review. Interna- tional Journal ... purposes) Journal of Brachial Plexus and Peripheral Nerve Injury Open Access Case report Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt
... bp (-240~+50) PAX5β-TF PAX5β-TR CGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTG GGCCAGTGAATTGTAATACGACTCACTATAG GGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC 301 bp (-92~+141) Quantitative MSP primers DAPK-qF DAPK-qR AG(C/T)G(C/T)GGAGTTGGGAGGAGTA CAAAC (A/ G)ACCAATAAAAACCCTACAAAC 121 ... Primer RASSF 1A- TF RASSF 1A- TR CGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTT GGCCAGTGAATTGTAATACGAC...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Medroxyprogesterone improves nocturnal breathing in postmenopausal women with chronic obstructive pulmonary disease" pps
... Although the maximum inspiratory slope was already at baseline within normal postmenopausal range, MPA almost dou- bled the slope. This finding is in line with the thinking that the baseline respiratory ... recordings, par- ticipated in the analyses and interpretation of data, and drafted the manuscript. TA constructed the analysis model for tcCO 2 signal, partic- ipated in the ana...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "Impaired urge-to-cough in elderly patients with aspiration pneumonia" doc
... takae_montreal@hotmail.com; Miyako Yamasaki - ymskmyk@idac.tohoku.ac.jp; Takaaki Asamura - t- asamuraum777@silk.plala.or.jp; Masanori Asada - m-asada@idac.tohoku.ac.jp; Kaori Une - unekaori@hotmail.com; Hiroyuki Arai ... Takae Ebihara, Miyako Yamasaki, Takaaki Asamura, Masanori Asada, Kaori Une and Hiroyuki Arai Address: Department of Geriatrics and Gerontology, Institute of Development...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo y học: "Vacuum-assisted closure device in intensive care unit patients and dissemination of Gram-negative bacteria" pptx
... dedicated portable devices) by nurses and physicians can reduce this critical problem, and during VAC use in particular, a correct sponge appli ca- tion and effi cient planning of vacuum use managed ... In the report of Papanikolaou and colleagues, we under stand that patients developed fi stulas before VAC applications and not as a result of their use. In cases like these,...
Ngày tải lên: 13/08/2014, 20:21