Báo cáo y học: " Dissemination of Strongyloides stercoralis in a patient with systemic lupus erythematosus after initiation of albendazole: a case report" docx
Báo cáo y học: " Dissemination of Strongyloides stercoralis in a patient with systemic lupus erythematosus after initiation of albendazole: a case report" docx
... improvement after institution of ivermectin. Case presentation A 38-year-old woman emigrated from the DominicanRepublic 1 year prior to presentation with complaints of 6days of abdominal pain and blood-flecked ... andEscherichia coli. After 10 days of ivermectin and consistently negative stoolexamination for ova and parasites, antiparasitic therapywas discontinued. The patient was continued on appropri-ate antibiotics ... completion of therapy.This case is unusual because disseminated diseaseoccurred 3 days after initiation of therapy with albenda-zole. We are uncertain why dissemination occurred in thistime...
- 3
- 277
- 0
Báo cáo y học: "CD147 overexpression on synoviocytes in rheumatoid arthritis enhances matrix metalloproteinase production and invasiveness of synoviocytes" pptx
... 5'-ACATCAACGAGGGGGAGACG-3'and 5'-GGCTTCAGACAGGCAGGACA-3' for CD147 (492bp); and 5'-CTGAACGGGAAGCT CACTGG-3' and 5'-TGAGGTCCACCACCCTGTTG-3' for glyceraldehyde ... the lining and sublininglayers of RA synovium, and macrophages acted as the ampli-fier of the pathogenetic cascade in RA via the increase of MMP production by interacting macrophages with fibroblasts[10]. ... hepatoma-associated antigen cloned by hepatoma mono-clonal antibody HAb18 from a human hepatocellular carci-noma cDNA library. HAb18G is a highly glycosylatedtransmembrane protein of 60 kDa with an ectodomain...
- 12
- 339
- 0
Báo cáo y học: "Leukocyte numbers and function in subjects eating n-3 enriched foods: selective depression of natural killer cell levels" potx
... University of South Australia, Australia, Adelaide SA 5000, Australia4Discipline of Paediatrics, University of Adelaide, 72 King William Road, North Adelaide SA 5006, AustraliaCorresponding author: ... treatment of autoimmuneand allergic inflammatory conditions [1-4]. Counterbalancingn-6 fatty-acid intake with n-3 fatty acids is important becausen-6 fatty acids, such as arachidonic acid (AA) ... enzyme-linked immunosorbent assay [18].Statistical analysisAll statistical analyses were performed using GraphPad InStatsoftware. Data were analyzed as comparisons between pla-cebo and n-3 PUFA-supplemented...
- 11
- 469
- 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
... Tanaka Y, Marusawa H, Seno H, Matsumoto Y, Ueda Y, Kodama Y, Endo Y, Yamauchi J, Matsumoto T, Takaori-Kondo A, et al.: Anti-viral protein APOBEC3G is induced by interferon-alphastimulation in ... HIV-1propagation was seen only at an early time point follow-ing initiation of the co-culture (i.e. 2 days) and was rap-idly lost thereafter is indicative of a modulatory effect onintricate interactions ... infections can damage the epithelialbarrier and cause microbial translocation leading ulti-mately to inflammation and activation of mDCs and mac-rophages. In steady-state, resident flora of...
- 16
- 288
- 0
Báo cáo y học: "Culture-negative bivalvular endocarditis with myocardial destruction in a patient with systemic lupus erythematosus: a case report." ppsx
... vena cava, dome of the l eft atrium,right atrium, and intra-atrial septum.Valve tissue was sent for pathology and microbiologicanalysis. The patient was started on vancomycin andciprofloxacin. ... participated in the care of the patient and wrote the initial manuscript.BS participated in the care of the patient and edited the manuscript. Allauthors participated in approving the final ... AccessCulture-negative bivalvular endocarditis with myocardial destruction in a patient with systemic lupus erythematosus: a case reportBrett R Laurence*and Byungse SuhAbstractCulture-negative endocarditis...
- 4
- 221
- 0
Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx
... T, Karampelas Ioannis, Karydas Georgios, Karabinis Andreas:Unilateral and bilateral vertebral artery dissection followingmotor vehicle injury – two cases and a mini-review. Interna-tional Journal ... purposes)Journal of Brachial Plexus and Peripheral Nerve InjuryOpen Access Case reportTraumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracturesSilas ... that the accuracy of CTA in vertebral injury remains in question. It was Alex-ander L. Eastman et al. [12] in a large series of 162 patient who demonstrated that CTA is a very good screening toolfor...
- 4
- 371
- 0
Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt
... bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301 bp(-92~+141)Quantitative MSP primersDAPK-qFDAPK-qRAG(C/T)G(C/T)GGAGTTGGGAGGAGTACAAAC (A/ G)ACCAATAAAAACCCTACAAAC121 ... PrimerRASSF 1A- TFRASSF 1A- TRCGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTTGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCCCAAAATCCAAACTAAAC337 bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 ... bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301...
- 12
- 383
- 0
Báo cáo y học: " Medroxyprogesterone improves nocturnal breathing in postmenopausal women with chronic obstructive pulmonary disease" pps
... Althoughthe maximum inspiratory slope was already at baselinewithin normal postmenopausal range, MPA almost dou-bled the slope. This finding is in line with the thinkingthat the baseline respiratory ... recordings, par-ticipated in the analyses and interpretation of data, anddrafted the manuscript.TA constructed the analysis model for tcCO2 signal, partic-ipated in the analyses and interpretation ... and interpretation of tcCO2 dataand in the statistical analyses, and drafted the manuscript.KU participated in the analyses and interpretation of tcCO2 data, and drafted the manuscript.OP...
- 12
- 293
- 0
Báo cáo y học: "Impaired urge-to-cough in elderly patients with aspiration pneumonia" doc
... takae_montreal@hotmail.com; Miyako Yamasaki - ymskmyk@idac.tohoku.ac.jp; Takaaki Asamura - t-asamuraum777@silk.plala.or.jp; Masanori Asada - m-asada@idac.tohoku.ac.jp; Kaori Une - unekaori@hotmail.com; Hiroyuki Arai ... Takae Ebihara, Miyako Yamasaki, Takaaki Asamura, Masanori Asada, Kaori Une and Hiroyuki AraiAddress: Department of Geriatrics and Gerontology, Institute of Development, Aging and Cancer, Tohoku ... University, Seiryo-machi 4-1, Aoba-ku, Sendai 980-8575, JapanEmail: Shinsuke Yamanda - debunda@hotmail.com; Satoru Ebihara* - sebihara@idac.tohoku.ac.jp; Takae Ebihara - takae_montreal@hotmail.com;...
- 6
- 334
- 0
Báo cáo y học: "Vacuum-assisted closure device in intensive care unit patients and dissemination of Gram-negative bacteria" pptx
... dedicated portable devices) by nurses and physicians can reduce this critical problem, and during VAC use in particular, a correct sponge appli ca-tion and effi cient planning of vacuum use managed ... In the report of Papanikolaou and colleagues, we under stand that patients developed fi stulas before VAC applications and not as a result of their use. In cases like these, the optimal ... et al.: Vacuum-assisted closure device in intensive care unit patients and dissemination of Gram-negative bacteria. Critical Care 2010, 14:413.Papanikolaou et al. Critical Care 2010, 14:413...
- 2
- 292
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật