Báo cáo y học: " No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km ultra-runners - a randomized controlled trial" potx

Báo cáo y học: " No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km ultra-runners - a randomized controlled trial" potx

Báo cáo y học: " No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km ultra-runners - a randomized controlled trial" potx

... have an effect on variables of skeletal muscle damage rather in a multi-stage race than in a single ultra-marathon. It has been shown that the oral administration of amino acids resulted in a ... RESEARCH ARTICLE Open Access No effect of short-term amino acid supplementation on variables related to skeletal muscle damage in 100 km...

Ngày tải lên: 11/08/2014, 23:21

8 290 0
Báo cáo y học: "No effect of omeprazole on pH of exhaled breath condensate in cough associated with gastro-oesophageal reflux" pdf

Báo cáo y học: "No effect of omeprazole on pH of exhaled breath condensate in cough associated with gastro-oesophageal reflux" pdf

... purposes) Capsaicin cough challenge Capsaicin (8-methyl-N-vanillyl-6-nonenamide, 98%) obtained from Sigma-Aldrich, Gillingham, UK, was dis- pensed from a nebuliser chamber attached to a breath- activated ... the nongaseous components of the expiratory air. Subjects breathed tidally through a mouthpiece and a two-way non-rebreathing valve, which also served as a saliva trap. They...

Ngày tải lên: 13/08/2014, 08:20

4 256 0
Báo cáo y học: " The effect of maternal common mental disorders on infant undernutrition in Butajira, Ethiopia: The P-MaMiE study" pot

Báo cáo y học: " The effect of maternal common mental disorders on infant undernutrition in Butajira, Ethiopia: The P-MaMiE study" pot

... Faculty of Medicine, Addis Ababa University, Addis Ababa, Ethiopia, 6 Department of Paediatrics and Child Health, Faculty of Medicine, Addis Ababa University, Addis Ababa, Ethiopia, 7 Department ... postpartum depression on maternal-infant interaction: A meta-analysis. Nursing Research 1995, 44:29 8-3 04. 19. Tomlinson M, Cooper P, Murray L: The mother-infant relationship and...

Ngày tải lên: 11/08/2014, 16:22

13 374 0
Báo cáo y học: "The effect of voluntary fasting and dehydration on flicker-induced retinal vascular dilation in a healthy individual: a case report" doc

Báo cáo y học: "The effect of voluntary fasting and dehydration on flicker-induced retinal vascular dilation in a healthy individual: a case report" doc

... practically any change in the quantity and composition of the circulating fluid due to dehydration and/or fasting is also capable of alter- ing vascular dynamics and BP [13]. Indeed, Alghadyan et al. ... that despite hav- ing comparable intraocular and systemic 'pressure' condi- tions, the retinal vascular reactivity was blunted during voluntary fasting in a healthy, you...

Ngày tải lên: 11/08/2014, 23:21

7 356 0
Báo cáo y học: " Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages" docx

Báo cáo y học: " Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages" docx

... using the Absolute RNA extraction Kit (Stratagene) and amplified by RT-PCR using the following primers: 5&apos ;- ccgaattcaagcactatggagggagagaggaa-3' and 5'-ccgaattcatg catagtctggtacatcgtaggggtacttaggaagaggtggaagaggtgg-3'. ... human and mouse CyclinT1 (mCycT1), which has a tyrosine at residue 261 in place of the cysteine amino acid in hCycT1, causes almost a co...

Ngày tải lên: 12/08/2014, 23:20

12 357 0
Báo cáo y học: " Transient expression of bC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions" pptx

Báo cáo y học: " Transient expression of bC1 protein differentially regulates host genes related to stress response, chloroplast and mitochondrial functions" pptx

... inoculation of bC1 of ChLCB for Q-RTPCR analysis SAA SAA F: GAGACCCGGGATGTCCTGGCAAGAAAGCAT (30 MERS) SAAQPCR:AATTACAAAAGAGCCCCTAAATCCCTAAGC (30 MERS) SAA F2: GGAGAGGGCAACCGATGA (18 MERS) SAA QPCR2: ... 5’-AGGGAACGAG-3’ B-18 5’-CCACAGCAGT-3’ B-19 5’-ACCCCCGAAG-3’ B-20 5’-GGACCCTTAC-3’ Table 2 Conclusion of relative quantification methods of differentially expressed genes at two and fou...

Ngày tải lên: 11/08/2014, 21:21

12 402 0
Báo cáo y học: "Successful resuscitation of an elderly man with deep accidental hypothermia using portable extracorporeal circulation in the emergency department: a case report" pps

Báo cáo y học: "Successful resuscitation of an elderly man with deep accidental hypothermia using portable extracorporeal circulation in the emergency department: a case report" pps

... pressure became unobtainable. He arrived on a backboard with a cervical collar in place, his trachea intubated, and a 20 gauge intravenous line infus- ing 0.9% NaCl. Cardiopulmonary resuscitation (CPR) was ... emergency percutaneous veno-arterial femoral-femoral bypass in the ED using a self-contained, portable cardiopulmonary bypass (CPB) support system (PBS Portable Bypass Sys...

Ngày tải lên: 11/08/2014, 23:21

5 309 0
Báo cáo khoa học: " The effect of methyl sulphonyl methane supplementation on biomarkers of oxidative stress in sport horses following jumping exercise" doc

Báo cáo khoa học: " The effect of methyl sulphonyl methane supplementation on biomarkers of oxidative stress in sport horses following jumping exercise" doc

... has been pro- posed to constitute a defence system against oxidative and inflammatory damage [8]. Both NO and CO activate sol- uble-guanilyl cyclase (sGC), thus inducing and increase in intracellular ... has anti-inflammatory effects involving the mitogen-activated protein kinase path- way. Nature Med 2000, 6:42 2-4 28. 40. Henningsson RAP, Lundquist I: Evaluation of islet heme...

Ngày tải lên: 12/08/2014, 18:22

9 297 0
báo cáo hóa học:" Nutrition outcomes of HIV-infected malnourished adults treated with ready-to-use therapeutic food in sub-Saharan Africa: a longitudinal study" ppt

báo cáo hóa học:" Nutrition outcomes of HIV-infected malnourished adults treated with ready-to-use therapeutic food in sub-Saharan Africa: a longitudinal study" ppt

... outcomes of HIV-infected malnourished adults treated with ready -to- use therapeutic food in sub- Saharan Africa: a longitudinal study. Journal of the International AIDS Society 2011 14:2. Ahoua et al. ... Ciliberto HM, Manary MJ: Comparison of home-based therapy with ready -to- use therapeutic food with standard therapy in the treatment of malnourished Malawian children: a c...

Ngày tải lên: 20/06/2014, 08:20

9 408 0
Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes

... pylori infection to hyper- homocysteinemia. 5. Conclusion This study was the first study that analyzed as- sociation between H. pylori infection and hyperhomo- cysteinemia in normal subjects taking ... 71: 43 7-9 . 25. Patel P, Mendall MA, Carrington D, et al. Association of Helico- bacter pylori and Chlamydia pneumoniae in fections with coronary heart disease and cardiovascula...

Ngày tải lên: 31/10/2012, 14:34

7 579 1
w