Báo cáo y học: " Direct spread of thyroid follicular carcinoma to the parotid gland and the internal jugular vein: a case report" pot
... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Direct spread of thyroid follicular carcinoma to the parotid gland and the internal ... unusual metastasis of a thyroid follicular carcinoma including the histopathological and radiological findings. A woman was seen in the oto...
Ngày tải lên: 11/08/2014, 21:22
... immunocompetent German (Caucasian) man who presented with skin rash and fever (day 0). Due to the clinical appearance of a typical “varicella-like” rash phenotype, antiviral therapy with Brivudine was initiated ... initiate specific antiviral thera py. Serological markers (i.e. VZV-IgM and/ or VZV-IgG) are not appro- priate for the laboratory diagnosis of early varicella, becau...
Ngày tải lên: 12/08/2014, 04:20
... management of patients with valvular heart disease). Endorsed by the Society of Cardiovascular Anesthesiologists, Society for Cardiovascular Angiography and Interventions, and Society of Thoracic ... G, Flachskampf F, Hall R, Iung B, Kasprzak J, Nataf P, Tornos P, Torracca L, Wenink A, Guidelines on the management of valvular heart disease: The Task Force on the Managemen...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Cerebral misery perfusion diagnosed using hypercapnic blood-oxygenation-level-dependent contrast functional magnetic resonance imaging: a case report" potx
... [5]. Case presentation A 50-year-old Caucasian man was admitted with an acute right hemiparesis, affecting his arm, leg and face, and a right homonymous hemianopia. His vascular risk factors included ... factors included a 25 pack-year smoking history and a previous myocardial infarction. An initial computed tomography (CT) head scan and m agnetic resonance imaging (MRI) sca...
Ngày tải lên: 11/08/2014, 11:23
Báo cáo y học: " Growth factor-enriched autologous plasma improves wound healing after surgical debridement in odontogenic necrotizing fasciitis: a case report" doc
... presentation: A 69-year old Mexican male had a pain in the maxillar right-canine region and a swelling of the submental and submandibular regions. Our examination revealed local pain, tachycardia, ... tachycardia, and hyperthermia (39°C). The bilateral submental and sub- mandibular regions had a 10-cm diameter swelling and well-delimitated erythematous, hyperthermia,...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... by affecting both the growth-factor triggered activation of fibroblasts and the accumulation of T lymphocytes. The significance of this research for understanding the pathogenesis of RA (and potentially ... contribute directly to the pathogenesis of synovial inflammation and joint destruction has seen a ‘revival’ over the last couple of years [6,7]. This is ma...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Direct sequencing of the human microbiome readily reveals community differences" pps
... distances. In this analysis, PERMANOVA uses the UniFrac distances to compute a test statistic similar to an F-ratio, and then reports both the signicance of the statistic and the portion of variation ... meta- genomic data are so far available only from the gut and for a relatively few samples, and so the range of questions that can be addressed at prese...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: " Unintended spread of a biosafety level 2 recombinant retrovirus" ppsx
... gene of the viral genome whereas for the murine hybrid retrovirus primers T3R27s2 (CAGGGAGAACATGGTAATAGGA) and T3R2 7a2 (ACGACCTCTCCAAAGTATCCA) were used to amplify a region within the env gene. As ... infected cells and the primers SMRV-1s (GTTGGGAACCCAGGCTAAGCTG) and SMRV- 805 7a (GTAGGAGGGGAACCGGCTAC) for SMRV and T3R03s (AGGGGATTTATTGGATACACG), T3R3 2a (CATCGTGACC...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: " Rapid spread of mouse mammary tumor virus in cultured human breast cells" pot
... A8 B8 E8 F8 H8 F7 G7 Mtv17 t t a t c Mtv2 7201 aagtagataagcaagtatttctttctgatacacccacggttgataataataaacctgggggaaagggtgataaaaggcgtatgtgggaactttggttgactactttggggaactcagggg F6 G6 H6 A7 ... A7 a B7 C7 D7 g c E7 H7 A8 B8 E8 F8 a a a H8 F7 c G7 Mtv17 g a c g Mtv2 7321 ccaatacaaaactggtccctataaaaaagaagttgccccccaaatatcctcactgccagatcgcctttaagaaggacgccttctgggagggagacga...
Ngày tải lên: 13/08/2014, 05:22
Báo cáo y học: "Direct effects of modest hyperglycaemia on susceptibility to infection in the critically ill patien" docx
Ngày tải lên: 13/08/2014, 11:23