Báo cáo y học: " Successful long-term monotherapy with rituximab in a patient with chronic lymphocytic leukemia of the B-cell-lineage: a case report" pdf
Báo cáo y học: " Continuing or adding IL-2 in patients treated with antiretroviral therapy (ACTG Protocol A5051, a rollover trial of ACTG Protocol A3" pps
... this article as: Bosch et al.: Continuing or adding IL-2 in patientstreated with antiretroviral therapy (ACTG Protocol A5 051, a rollover trial of ACTG Protocol A3 28). AIDS Research and Therapy ... immunologic, andclinical effects of interleukin 2 with potent antiretroviral therapy in patients with moderately advanced human immunodeficiency virusinfection: a randomized controlled clinical trial–AIDS ... [1-3].AIDS Clinical Trial Group (ACTG) study A5 051 was anopen-label study that explored continuation therapy with IL-2 for patients who had participated in A3 28 [4]. A3 28enrolled patients with...
- 5
- 392
- 0
Báo cáo y học: "Off-pump coronary artery bypass in poland syndrome with dextrocardia: case report" pdf
... ours is the first report of OPCABG in a case of Poland synd rome with dextrocardia and only the second case report of coronary artery bypass in Poland syndrome.Any concerns about an insufficient ... WeencounteredacaseofleftsidedPolandsyndromeasso-ciated with dextrocardia who presented to us with coronary artery disease and successfully underwentoff-pump coronary artery bypass grafting (OPCABG). Case ... 6:75http://www.cardiothoracicsurgery.org/content/6/1/75Page 2 of 3 CASE REP O R T Open AccessOff-pump coronary artery bypass in polandsyndrome with dextrocardia: case reportVivek Srivastava1*, Ranjit More2and Augustine Tang1AbstractPoland...
- 3
- 414
- 0
Báo cáo y học: "Effective cardiac resynchronization therapy for an adolescent patient with dilated cardiomyopathy seven years after mitral valve replacement and septal anterior ventricular exclusio" ppsx
... restricted the possible pacing site.We placed an atrial lead at the right appendage and a RVlead at the apex. A LV lead was placed at the lateral wall of the coronary sinus because there was the possibility ... Update Incorporated Into the ACC/AHA 2005 Guidelines for the Diagnosis and Management of Heart Failure in Adults A Report of the American College of Cardiology Foundation/American Heart Association ... ward of Kyoto university hospital. TD is an assistant professorand a cardiologist in charge in a cardiovascular ward of Kyoto university hospi-tal. HD is an assistant professor and a pediatric...
- 4
- 233
- 0
Báo cáo y học: " Does monitoring need for care in patients diagnosed with severe mental illness impact on Psychiatric Service Use? Comparison of monitored patients with matched controls" pptx
... flexibly across in- patient and out -patient care solutions. This way the availability of in- patient or out -patient care is easier to adapt to the needs in the patient population. However, the health ... day care waslower in the CNCM region compared to the NN region,both in the year after and in the year before t he indexdate (table 2).Comparing care in the year before and the year after the ... by a decrease in in -patient caremay be a consequence of the bed capacity in the region. The differences in care consumption between the CNCMand NN regions may indicate an overcapacity of in- patient...
- 7
- 260
- 0
Báo cáo y học: "Bronchial hyperreactivity and spirometric impairment in polysensitized patients with allergic rhinitis" doc
... involvement of small airways in the patho-genesis of asthma [6]. Even though there is no directparameter cap able of assessing small airways, it has beenassumed that the forced expiratory flow at the ... revised the manuscript, and AV participated in the clinical study.All authors read and approved the final manuscript.References1. Pederson PA, Weeke ER: Asthma and allergic rhinitis in the same patients. ... Maria A Tosca - MariangelaTosca@ospedale-gaslini.ge.it; Andrea Vizzaccaro - vizzaccaro@libero.it* Corresponding author allergic rhinitispolysensitizationbronchial hyperreactivitymethacholine...
- 6
- 269
- 0
Báo cáo Y học: Rapid caspase-dependent cell death in cultured human breast cancer cells induced by the polyamine analogue N1,N11-diethylnorspermine pdf
... mportance of a balance of polyamine levels in the cell. Careful regulation of the transport of polyamines in and out of the cell also participates in keeping the polyamine pools a t an a ppropriate ... polyamines by downregulating the activity of the biosynthetic e nzymes and upregulating the activity of the catabolic enzyme spermidine/spermine N1-acetyltrans-ferase (SSAT) [8]. The effect of ... resulted in a decrease in the polyamine pools. The spermine analogue thus activated the catabolism of the natural polyamines. DENSPM presum-ably also decreased the activities of biosynthetic enzymes.However,...
- 7
- 326
- 0
Báo cáo y học: "Homoeolog-specific retention and use in allotetraploid Arabidopsis suecica depends on parent of origin and network partners" doc
... expressionbetween At, Aa, and F1As. More than 15% of transcriptsAT1G65450.1GGTTTTAACCGCATACGCAAAGGAGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT AGAAAT GGTAGG AGAAGGGTCAAA GAGGAT AACGGA TGAGTAT GCGCGGTCT ... T. G G A T T .G T C .G G A T T G T T C .G G A T. T .G T . GCAGTTTTAACTGCTTACGCAAAGGCGAAATG CAAGGC ATTGCTTGAAGA GCCGTT TGGGAGGATTGT GGAAAT AGTAGG TGATGGGGCAAA TAGGAT AACGGA TGAGTAT GCGCGGTCT ... shown above.Analysis of DFs in As transcriptsSinceweareestimatingtherelativecontributionofAarather than the absolute, the expression level of everygene in the As transcriptome was normalized...
- 17
- 336
- 0
Báo cáo y học: " Successful long-term monotherapy with rituximab in a patient with chronic lymphocytic leukemia of the B-cell-lineage: a case report" pdf
... chlorambucil and fludarabine, a patient with chronic lymphocytic leukemia of the B-cell-lineage was successfully treated with rituximab. Introduction Chronic lymphocytic leukemia of the B-cell-lineage ... rituximab wastapered, with two administrations of 375 mg/m2 in Janu-ary and in April 2006. Since WBCs started to rise again 7months after the last administration, rituximab mainte-nance therapy ... ReportsOpen Access Case report Successful long-term monotherapy with rituximab in a patient with chronic lymphocytic leukemia of the B-cell-lineage: a case reportIsrid Sturm*1, Joachim Oertel1,...
- 5
- 257
- 0
Báo cáo y học: "Successful immunotherapy with matrix metalloproteinasederived peptides in adjuvant arthritis depends on the timing of peptide administration" pdf
... Iwahori Y, Nagaya I, Hasegawa Y, Iwata H: mRNA expression of matrix metalloproteinases andtissue inhibitors of metalloproteinase in interface tissuearound implants in loosening total hip arthroplasty. ... Supplementary material).Lymphocyte proliferation of MMP peptide-treated ratsTo analyze whether the interference in AA after nasaladministration of MMP-10329–343or MMP-16539–553wasaccompanied by ... error of the mean.MHC class II–peptide binding assaySee Supplementary material for full details of the MHCclass II–peptide binding assay.Ex vivoproliferation assaysSee Supplementary material...
- 8
- 411
- 0
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... reportDaisuke Yoshioka, Toshiki Takahashi*, Toru Ishizaka and Takuya HiguchiAbstractCardiac myxoma is the most common primary cardiac tumour, but infected cardiac myxoma is relatively rare.Infected ... immunogloburin and intrave-nous antibiotic therapy with ampicillin, his generalcondition was getting better and was extubated at the second postoperative day. The antibiotic therapy with ampicillin was ... CAS E REP O R T Open Access Successful surgical resection of infected left atrialmyxoma in a case complicated with disseminatedintravascular coagulation and multiple cerebralinfarctions: case...
- 4
- 543
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam