Báo cáo y học: " Paraneoplastic limbic encephalitis as a cause of new onset of seizures in a patient with non-small cell lung carcinoma: a case report" potx

... Access Case report Paraneoplastic limbic encephalitis as a cause of new onset of seizures in a patient with non-small cell lung carcinoma: a case report Vasileios Voutsas* 1 , Efrosyni Mylonaki 1 , ... presence of an associated tumor. Conclusion Paraneoplastic limbic encephalitis is a possible cause of seizures in patients with...

Ngày tải lên: 11/08/2014, 21:22

... recognized and treated early in the course of the disease. Case Presentation: A 65-year-old Caucasian woman presented with generalized tonic-clonic seizures and increasing confusion shortly after a lung ... our case of PLE is the clinical course of neuropsychiatric manifestation in relation to the discovery of the underlying malignancy. In a recent case repor...

Ngày tải lên: 11/08/2014, 12:20

... is increasing evidence that n-3 polyunsaturated fatty acids (PUFAs) exhibit anti- inflammatory properties in many inflammatory diseases while n-6 PUFA arachidonic acid (AA) favors inflammatory ... Khashayar R, Wong HH, Ferrando R, Wu R, Hyde DM, Hotchkiss JA, Zhang Y, Novikov A, Dolganov G, Fahy JV: Mild and moderate asthma is associated with airway goblet cell hyperplasia and abnorma...

Ngày tải lên: 12/08/2014, 15:20

... and harvested separately for microarray analysis. Microarray and cluster analysis All experiments for microarray analysis were performed inde- pendently, in triplicate, to facilitate statistical analysis. ... generated by PCR from genomic DNA using the following pairs of primers: hairy forward (F), 5'CAAATTGGAAAAGGCCGACA3'; hairy reverse (R), 5'AGAGAAACCCTAAGCGGCTT3';...

Ngày tải lên: 14/08/2014, 15:20

... cardiovascular reflex testing it has been shown that both sympathetic as well as parasympathetic dys- function can occur in patients with MS (12-16). Re- duced heart rate variability and vasomotor ... occur because of involvement of several critical pathways of autonomic nervous system, including the brain stem, spinal cord, hypothalamus and cerebral cortex. Demyelinating p...

Ngày tải lên: 26/10/2012, 09:39

... linkage to the avian influenza is doubtful. 2. History of the Disease The influenza virus is of animal origin and its infection of humans may date back as early as 2000 B.C.E. when humans ... mammalian hosts. These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans. Pigs can be infected with both avian and...

Ngày tải lên: 02/11/2012, 11:12

... few years [22–26] have clearly indicated that the same nontoxic concentrations of ouabain that cause partial inhibition of Na + /K + -ATPase and an increase in cardiac contractility, also stimulate ... myocytes. Pathways that are independent of changes in intracellular ions Because the cardiac myocyte plasma membrane contains a highly active Na + /Ca 2+ -exchanger, the most sign...

Ngày tải lên: 24/03/2014, 00:21

... 20 Angioedema is a common presenting symptom among allergy practices. Angioedema is caused by increased vascular permeability in the subcuta- neous tissue of the skin and respiratory and gas- trointestinal ... Protoporphyria Masquerading as Angioedema in a 4-Year-Old Female Helen C. Wang, MD; Ejaz Yousef, MD Abstract Angioedema is a common presentation with a broad different...

Ngày tải lên: 08/08/2014, 21:20

... from animals cannot always be extrapolated to humans. Bjelle [36] has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in load- bearing areas. ... of aggrecan and type II collagen in OF and OA cartilage. Ratio of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas...

Ngày tải lên: 09/08/2014, 08:22

... activity score and hand bone loss At baseline 55 patients had low disease activity, 103 patients had moderate disease activity and 44 patients had high dis- ease activity. Bone loss changes, as measured ... only takes place in the first 3 years of disease duration [7]. Table 1 Patient characteristics at baseline and at 2-year follow-up Variable n Baseline At 2-year follow-up Demograp...

Ngày tải lên: 09/08/2014, 10:20