Báo cáo y học: " Challenges in the prenatal and post-natal diagnosis of mediastinal cystic hygroma: a case report" docx

... Nakazato Y, Ohno Y, Nakata Y, Yamaguchi H, Hazato N, Nagasawa S, Yokoyama M, Yamada T: Cystic lymphangioma of the medi- astinum. Am Heart J 1995, 129:406-409. 3. Omell GH, Anderson LS, Bramson ... cervical hygromas, as 1% to 2% of cervical cystic hygromas have mediastinal extensions [5]. Isolated intrathoracic cystic hygroma is a rare finding; less than 1% of all cystic...

Ngày tải lên: 11/08/2014, 21:22

... chest radio- graph showed an air-fluid level within a dilated stomach (Figure 2a) . In view of the examination and chest radiograph findings, she had a nasogastric tube and urinary catheter inserted for ... morbidity and mortality. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy o...

Ngày tải lên: 11/08/2014, 21:22

... certainly a low awareness of AS among nonrheumatologists and it can be seen as a major challenge for any physician in primary care to think of and to identify patients with inflammatory spine ... inflammatory back pain and/ or an asymmetrical arthritis predominantly of the lower limbs. These criteria already used the division into axial and peripheral SpA. The Amor cr...

Ngày tải lên: 09/08/2014, 01:22

... with a variety of proteins within the cytoplasm and to play a key role in the modulation of inflammation and apoptosis [11]. Many of its interactions appear to involve its 90-amino acid N-terminal ... elucidating the pathogenesis of many autoinflammatory diseases has led to major advances in their treatment, most remarkably the introduction of IL-1 inhibition in...

Ngày tải lên: 09/08/2014, 01:22

... safety and benefits of physical training are interesting and there are sufficient scientific data to advocate exercise training as a component of modern treatment of polymyositis and dermatomyositis. ... P: A motif in human histidyl-tRNA synthetase which is shared among several aminoacyl-tRNA synthetases is a coiled-coil that is essential for enzymatic activity and con-...

Ngày tải lên: 09/08/2014, 13:21

... is the main factor that facilitates the formation of MSU crystals, although other factors (such as local temperature and trauma) may also play a role. Once formed, urate crystals are capable of ... life expectancy and age of the population. Uric acid metabolism Uric acid is the end result of the purine metabolic pathway and the product of the conversion of xa...

Ngày tải lên: 09/08/2014, 13:22

... and concomitantly reduced parasympathetic activity [50]. The basal autonomic state of patients with FM was characterized by increased sympathetic and decreased parasympathetic tones in women with ... the biological basis in general – and the genetic underpinning, in particular – of FM increases, we hope to gain a better understanding of the true nature of the d...

Ngày tải lên: 09/08/2014, 14:21

... revised the manuscript. AEW conceived the study and was involved in study design, data interpretation, and manuscript drafting and revision. All authors read and approved the final manuscript. Acknowledgements This ... Raffin TA, Atlas SW: Ethical and practical considerations in managing incidental findings in functional magnetic resonance imaging. Brain Cogn 2002, 50:35...

Ngày tải lên: 09/08/2014, 10:22

... KK and SS clinically managed the patient and initially drafted the manuscript. VN and SH interpreted the patient data and were major contributors in writing and revising the manuscript. All authors ... complicated by dengue viral infection: a case report Dilip Dan, Kevin King, Shiva Seetahal , Vijay Naraynsingh and Seetharaman Hariharan * Abstract Introduction: Porta...

Ngày tải lên: 11/08/2014, 00:23

... RM: The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: Inhibiting the 2’-5’ oligo (A) synthetase/RNase L pathway. Proceedings of the National Academy of Sciences ... forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ , resulting a product of 550 bp; and b-actin forward 5’ TGGGTCAGAAGGACTCCTAT...

Ngày tải lên: 11/08/2014, 21:21