Báo cáo y học: " Challenges in the prenatal and post-natal diagnosis of mediastinal cystic hygroma: a case report" docx

... Nakazato Y, Ohno Y, Nakata Y, Yamaguchi H, Hazato N, NagasawaS, Yokoyama M, Yamada T: Cystic lymphangioma of the medi-astinum. Am Heart J 1995, 129:406-409.3. Omell GH, Anderson LS, Bramson ... cervicalhygromas, as 1% to 2% of cervical cystic hygromas have mediastinal extensions [5].Isolated intrathoracic cystic hygroma is a rare finding; lessthan 1% of all cystic hygromas are purely mediastinal in origin. ... postoperatively. We offer an overview of the role of imaging and suggest that both the local anat-omy and the organisation of the cystic structure be borne in mind in the assessment of these mediastinal...

Báo cáo y học: "Bezoar in gastro-jejunostomy presenting with symptoms of gastric outlet obstruction: a case report and review of the literature" pdf

... chest radio-graph showed an air-fluid level within a dilated stomach(Figure 2a) . In view of the examination and chest radiograph findings,she had a nasogastric tube and urinary catheter insertedfor ... morbidity and mortality.ConsentWritten informed consent was obtained from the patientfor publication of this case report and any accompanyingimages. A copy of the written consent is available ... early in patients athigher risk of developing bezoars. The classical appear-ance of a bezoar on computed tomography is a well-defined ovoid intraluminal mass with mottled gas patternat the...

Báo cáo y học: "Developments in the scientific and clinical understanding of the spondyloarthritides" pptx

... certainly a low awareness of ASamong nonrheumatologists and it can be seen as a majorchallenge for any physician in primary care to think of and toidentify patients with inflammatory spine ... inflammatory back pain and/ or an asymmetricalarthritis predominantly of the lower limbs. These criteriaalready used the division into axial and peripheral SpA. The Amor criteria published in 1990 by Amor ... ASAS20,ASAS40, and ASAS partial remission criteria, respectively) of clinical symptoms. Andrei Calin, of Bath, UK, had started thiskind of work in the early 90s with the definition of the BathAnkylosing...

Báo cáo y học: "Developments in the scientific and clinical understanding of autoinflammatory disorders" doc

... with a variety of proteins within the cytoplasm and to play a key role in the modulation of inflammation and apoptosis [11]. Many of its interactionsappear to involve its 90-amino acid N-terminal ... elucidating the pathogenesis of manyautoinflammatory diseases has led to major advances in theirtreatment, most remarkably the introduction of IL-1 inhibition in CAPS. The clinical significance of ... of the IgM paraproteinaemia can beachieved. A pivotal role of IL-1 in the pathogenesis of thisacquired disorder has lately been suggested by remarkabletherapeutic efficacy of anakinra in a...

Báo cáo y học: "Developments in the scientific and clinical understanding of inflammatory myopathies" pps

... safety and benefits of physical training areinteresting and there are sufficient scientific data to advocateexercise training as a component of modern treatment of polymyositis and dermatomyositis. ... P: A motif in human histidyl-tRNA synthetasewhich is shared among several aminoacyl-tRNA synthetasesis a coiled-coil that is essential for enzymatic activity and con-tains the major autoantigenic ... prostaglandinsProinflammatory cytokines, chemokines, and prostaglandins and some anti-inflammatory cytokines such as transforminggrowth factor-beta have been found in myositis muscle tissue.Major...

Báo cáo y học: "Developments in the scientific and clinical understanding of gout" docx

... is the main factor that facilitates the formation of MSU crystals, although other factors (such as localtemperature and trauma) may also play a role. Once formed,urate crystals are capable of ... lifeexpectancy and age of the population.Uric acid metabolismUric acid is the end result of the purine metabolic pathway and the product of the conversion of xanthine, by the action of xanthine oxidase, ... febuxostat and uricase increase the range of treatmentoptions available to patients who are intolerant to allopurinol and uricosuric agents. The other major therapeutic target is the inflammatory...

Báo cáo y học: "Developments in the scientific and clinical understanding of fibromyalgia" pdf

... and concomitantly reduced parasympatheticactivity [50]. The basal autonomic state of patients with FMwas characterized by increased sympathetic and decreasedparasympathetic tones in women with ... the biological basis in general – and the genetic underpinning, in particular – of FM increases, we hope to gain a betterunderstanding of the true nature of the disorder, to attainmore rational therapeutic ... The authors concluded that pregabalin provides clinicallymeaningful benefit to patients with FM. In another study Mease and colleagues evaluated the safely and efficacy of milnacipran, a dual...

Báo cáo y học: "What is the clinical and ethical importance of incidental abnormalities found by knee MRI" docx

... revised the manuscript. AEW conceived the study and was involved in study design, data interpretation, and manuscript drafting and revision. All authors read and approved the final manuscript.AcknowledgementsThis ... Raffin TA, Atlas SW: Ethical and practical considerations in managing incidental findings in functional magnetic resonance imaging. Brain Cogn 2002,50:358-365.8. Mamourian A: Incidental findings ... unsuspected abnormalities or inciden-tal findings. In the non-clinical research setting, any abnormal-ity, even if finally diagnosed as benign, is a matter of medical and ethical concern: the researcher...

Báo cáo y học: "Portal vein thrombosis following laparoscopic cholecystectomy complicated by dengue viral infection: a case report" docx

... KK and SS clinically managed the patient and initially drafted the manuscript. VN and SH interpreted the patient data and were majorcontributors in writing and revising the manuscript. All authors ... complicated by dengue viralinfection: a case reportDilip Dan, Kevin King, Shiva Seetahal , Vijay Naraynsingh and Seetharaman Hariharan*AbstractIntroduction: Portal vein thrombosis is an uncommon ... posesinteresting challenges regarding the seemingly contra dic-tory fundamentals of management. Case presentation A 63-year-old woman of Asian Indian ethnicity pre-sented with complaints of biliary...

Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

... RM: The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: Inhibiting the 2’-5’ oligo (A) synthetase/RNase L pathway. Proceedings of the National Academy of Sciences ... forward5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ ,resulting a product of 550 bp; and b-actin forward5’ TGGGTCAGAAGGACTCCTATG 3’ and reverse5’ AGAAGAGCTATGAGCTGCCTG ... as the mRNA export machinery [29-34]. The N-terminal RNA binding domain binds to both sin-gle- and double-stranded RNA that might inhibit the activation and/ or signalling of antiviral proteins,...

Xem thêm

Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM