Báo cáo y học: " Response of pulmonary artery intimal sarcoma to surgery, radiotherapy and chemotherapy: a case report" docx

... the incidence of aortic intimal sarcoma. The mean age of patients diagnosed with PA intimal sarcoma is 48 years, while the mean age of patients at diagnosis of aortic inti- mal sarcoma is 62 years [3,4]. PA ... Uchida A, Tabata M, Kiura K, Tanimoto Y, Kanehiro A, Aoe M, Ohohara N, Ueoka H, Tanimoto M: Successful treatment of pul- monary artery sarcoma by a two-drug...

Ngày tải lên: 11/08/2014, 21:22

... Histologically sheets and aggre- gates of histiocytes (von Hansemann cells) with fine eosinophilic granular cytoplasm are seen on haematoxy- lin and eosin stain. They are characterised by intracellular and ... CD68, lysozyme and α-chymotrypsin. Blackshear first reported Malakoplakia in the appendix in 1970 in a case of pulmonary nocardiosis [2]. Since then four more cases o...

Ngày tải lên: 11/08/2014, 23:21

... no association between plasmapheresis treatment and acute onset of facial neuropathy has been reported. Case presentation: A 35-year-old Caucasian man with no significant prior medical history ... cerebellar abnormalities were evident. His gait was unsteady and wide-based and he displayed an inability to tandem walk. Cerebral spinal fluid showed cytoalbuminologic disso- ciation...

Ngày tải lên: 11/08/2014, 03:21

... tracheotomy. He was discharged on day 46 in a stable condition to an acute rehabilitation facility. At that point he had mild facial weakness, was able to symmetrically produce a small smile and ... evident. His gait was unsteady and wide-based and he displayed an inability to tandem walk. Cerebral spinal fluid showed cytoalbuminologic disso- ciation with a protein of 51 m...

Ngày tải lên: 11/08/2014, 07:20

... and she has no residual clinical sequelae per- taining to PVT and/ or dengue infection. Discussion Balfour and Stewart r eported a case of PVT as early as 1868. With the advent and easy availability ... absent. She had mild -to- moderate dehydration and was admitted for rehydration therapy and further investigation. Laboratory reports showed elevation of liver enzymes a...

Ngày tải lên: 11/08/2014, 00:23

... media and mastoiditis: a case report Che M Harris, Micean Johnikin, Hope Rhodes, Theresa Fuller, Sohail R Rana, Hasan Nabhani, Dulara Hussain, Mohan Kurukumbi, Annapurni Jayam-Trouth, Jhansi Gajjala, ... appreciated. He was tachycardic wi th regular rhythm, clear breath sounds, and normal abdom- inal exam. He was alert and oriented to person, place, and time, and cranial nerve...

Ngày tải lên: 11/08/2014, 17:21

... indwelling central venous catheter: a case report Charita Pradhan 1 , Nicholas FS Watson* 1 , Nitin Jagasia 2 , Ray Chari 2 and Jane E Patterson 1 Address: 1 Department of General Surgery, Kings ... infection, renal failure and intravenous drug abuse. Case presentation: We report a rare case of bilateral sternoclavicular joint septic arthritis in an elderly patient sec...

Ngày tải lên: 11/08/2014, 23:21

... transcriptionally between these strains and that the A/ J may display a tendency toward continued activation of inflammatory genes or early activation of oncogenes compared to the B6 strain. Col- lectively, ... and allows 8 samples to be inter- rogated in parallel. To minimize array to array variability, a cRNA sample from each of the sham, GMA-MS and GMA-SS groups fr...

Ngày tải lên: 12/08/2014, 11:22

... cagacctc atggaggcca tgg gtaag gatgccgtgctgaat Heart cDNA and NM_011099 M-Pk-pair 5 tgtttagcagcagctttg ctatcattgccgtgactcga Heart cDNA and NM_011099 M-Pk-pair 6 caccgtctgctgtttgaaga ctatcattgccgtgactcga ... gatcgctcagatcctggaag gagaaggatgttgggctgag NM_016701 PECAM1(CD31) tgcaggagtccttctccact acggtttgattccactttgc NM_008816 CD14 ctgatctcagccctctgtcc gcttcagcccagtgaaagac NM_009841 Cyclophilin...

Ngày tải lên: 13/08/2014, 13:20

... significant uptake. Histological results of a biopsy taken from the mass were suggestive of low-grade MEC. Case 3 A 24-year-old Caucasian man presented with a one-year history of cough and haemoptysis. ... 1. Case 1 A 14-year-old Caucasian girl presented with a one-year history of cough and gradually progressive dyspnea. On clinical examination, decreased air entry w...

Ngày tải lên: 11/08/2014, 03:21