Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx
Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx
... HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+ L74I enzyme and a replication competent virus HimaBindu Chunduri 1 , David Rimland 2 , ... five independent processivity assays were performed f or each RT and statistical values that include mean, median, standard deviation and...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"
... (influenced by size and structure of the cell nucleus and by the quantity of vesicles) is changed and shows an increased fraction of more granulized MCF-7 cells in all treatments (TMZ, cRGD, and cRG ... resulting solution was deeply coloured and maintained for 4 h at room temperature. Then the organic phase was washed with water, followed by 1N HCl and ag...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"
... 3) Available Antiviral Therapy The current standard of therapy includes the combination of weekly pegylated interferon and daily ribavirin. The treatment duration and dosage, as well as the ... panel. Although the serum aminotransferase level correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) &g...
Ngày tải lên: 02/11/2012, 09:51
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
... application of HBV DNA quantitation and three approved drugs for HBV treatment, and presents an updated and practical clinical approach to managing CHB. Highly sensitive PCR-based quantitation of ... and serum transaminases are the most important parameters in determining indication, regimen, and duration of HBV treatment. Although interferon alfa-2b, lamivudine,...
Ngày tải lên: 03/11/2012, 09:41
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx
... 5¢-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3¢,5¢-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3¢ ,and5 ¢-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3¢, respectively. Production of recombinant chimera toxins ... receptor [45,48–50]. In addition, the spatial arrangement of the toxin polypeptide chain together with the formation of an electrostatic potential are also predicted to...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt
... salinity-stimulated kinase level is mediated via a Ca 2+ /CaM pathway To further confirm that the upregulation of PsCCaMK by NaCl and low temperature is mediated via a Ca 2+ /CaM signaling pathway, the plants were ... effects of EGTA and W7 on low temperature- and salinity-mediated expres- sion of PsCCaMK indicate that their responses are medi- ated by different signaling...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... mounting evidence that in ammatory cell in ltrates play a significant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro -in ammatory agents. ... approaches to immunomodulatory therapy. In an attempt to identify such new targets on in ammatory cells at sites of in ammation, we searched the Incyte EST databas...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... recently in reactions catalysed by lipoxygenase and mutants thereof [40]. We have attempted to gain an early insight into the effects of compromising mutations on catalysis by studying C–H and C–D ... to H-tunneling by a vibrationally assisted mechan- ism, although a Boltzman analysis suggests a very small population in anything other than the vibrational ground stat...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf
... Negative and General Psychopathology scales), the YMRS and the MADRS are shown in Table 4. The results of the factor analysis (varimax normalized rotation) are shown in Table 5. The analysis (by ... reliability and reproducibility of a method and its results, because it is an index of correlation and not an index of agreement [19-21]. The calculation...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "A combination of autoantibodies to cyclic citrullinated peptide (CCP) and HLA-DRB1 locus antigens is strongly associated with future onset of rheumatoid arthritis" potx
... analysed factors. In this study, calculations are based on the combination of SE and the analysed autoan- tibodies. This is because anti-CCP antibodies and RFs are significantly associated, and ... contributed to the preparation of the manuscript. SR-D was a main investigator, designed the investigation, was involved in all aspects of the study, and contribut...
Ngày tải lên: 09/08/2014, 01:23