Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf

Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf

Báo cáo y học: " In-vitro antiviral activity of Solanum nigrum against Hepatitis C Virus" pdf

... without compound (control). Figure 4 Antiviral effect of chloroform extract of Solanum nigrum against HCV NS3 protease. Huh-7 cells were transfected with 0.5 μg of constructed HCV NS3 protease vector ... Anti-HCV activity of methanol extract of Solanum nigrum. Huh-7 cells were incubated with HCV serum and 100 μg/μl concentration of Solanum nigrum seeds extract for...

Ngày tải lên: 11/08/2014, 21:21

7 419 0
Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

... and C- termini of HCV NS5A was amplified using sense and anti-sense overlapping primers (S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGT- GAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’- TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’). ... gene (sense 5’-ATCGAATT- CATCGTGGCTGGCCA-3’ ;anti-sense5’ -CTA- GAATTCGGCGCGAGCCCCTG-3’ ;probe5’- GCTTGGTGGTCGAATGGGCAG GTAGCCGGA-3’. Infectivity assay An infectivity assay...

Ngày tải lên: 12/08/2014, 04:21

16 391 0
Báo cáo y học: "No observed effect of homologous recombination on influenza C virus evolution" pptx

Báo cáo y học: "No observed effect of homologous recombination on influenza C virus evolution" pptx

... this study. Author details 1 State Key Laboratory of Crop Biology, College of Agronomy, Shandong Agricultural University, Tai’an, Shandong 271018, China. 2 Oxford University Clinical Research Unit, ... Unit, Ho Chi Minh City, Vietnam. 3 MRC Centre for Genomics and Global Health, University of Oxford, Oxford, UK. 4 Current Address: Department of Ecology and Evolutionary Biology, Univer...

Ngày tải lên: 12/08/2014, 01:21

3 375 0
Báo cáo y học: "Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx

Báo cáo y học: "Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx

... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived ... interests. Authors' contributions SR conceived of the study, participated in its design and coordination and gave a critical view of manuscript writ- ing. MI collected epidemiolog...

Ngày tải lên: 12/08/2014, 04:20

6 204 0
Báo cáo y học: "Anti-inflammatory activity of nanocrystalline silver-derived solutions in porcine contact dermatitis" pptx

Báo cáo y học: "Anti-inflammatory activity of nanocrystalline silver-derived solutions in porcine contact dermatitis" pptx

... Ethics Office (formerly Health Sciences Ani- mal Policy and Welfare Committee) and was conducted with humane care of the animals in accordance with guidelines established by the Canadian Council of ... at the University of Alberta, provided technical assistance with the atomic absorption spectroscopy. The Cell Imaging Facility of the Department of Oncology at the University of Alb...

Ngày tải lên: 11/08/2014, 08:22

20 370 0
Báo cáo y học: "Anti-inflammatory activity of monogalactosyldiacylglycerol in human articular cartilage in vitro: activation of an antiinflammatory cyclooxygenase-2 (COX-2) pathway" doc

Báo cáo y học: "Anti-inflammatory activity of monogalactosyldiacylglycerol in human articular cartilage in vitro: activation of an antiinflammatory cyclooxygenase-2 (COX-2) pathway" doc

... -AAAGTCGGAGTCAACG- GATTTG-3’ reverse 5’ -TGTAAACCATGTAGTTCAGATC- GATGA-3’ Type II Coll: forward 5’ -CGGCTGCACAAAACA- CACTGC-3’ reverse 5’-CCTTCCGCCCTGCAGAT-3’ Type I Coll: forward 5’ - CAGCCGCTTCACCTA- CAGC-3’ reverse ... of 12 RESEARC H ARTIC L E Open Access Anti-inflammatory activity of monogalactosyldiacylglycerol in human articular cartilage in vitro: activation of an anti- inflam...

Ngày tải lên: 12/08/2014, 17:21

12 285 0
Báo cáo y học: "Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation" docx

Báo cáo y học: "Dynamic cumulative activity of transcription factors as a mechanism of quantitative gene regulation" docx

... MB, Brown PO, Botstein D, Futcher B: Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cer- evisiae by microarray hybridization. Mol Biol Cell 1998, 9:3273-3297. 35. ... efficiency (C1 , C2 ) of each transcription factor 0 T T Shifted time Conversion efficiency Generate the combinatorial expression profile of the two regulators for each combinatio...

Ngày tải lên: 14/08/2014, 08:20

18 273 0
Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... specific in this respect. Sensitivities ranged from 64% for assay of Abs against teichoic acid to 72% for assays of antibody to peptidoglycan and α-toxin. The specificity of assays for antibody ... to cell wall peptidoglycan of Staphylococcus aureus in patients with serious staphylococcal infections. J Infect Dis 1981, 144(1):1-9. 31. Martin RR, Greenberg SB, Wallace RJ. Stap...

Ngày tải lên: 02/11/2012, 11:08

8 525 2
w