Báo cáo y học: " Hepatitis C virus genotypes circulating in district Swat of Khyber Pakhtoonkhaw, Pakistan" doc

... Epidemiology of HCV Genotypes in the Area of Lecce. J of Prev Med and Hygi 2000, 41:46-53. doi:10.1186/1743-422X-8-16 Cite this article as: Inamullah et al.: Hepatitis C virus genotypes circulating in district ... Ahmed 3 Abstract Hepatitis C virus (HCV) is the leading cause of chronic hepatitis worldwide and its subtypes /genotypes are clinically important...

Ngày tải lên: 11/08/2014, 21:21

... AB033555-Indonesia-(B) ATGAGTGGGAGGAGTTGGGGGAGGAGATCAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCATGTTCATGTCCTATTGTTCAAGCCTCCAAGCTGTGC DQ993709-Taiwan-(B) ... associated with HCC was low [40]. If BCP mutation is strongly associated with clinical out- come of liver disease including HCC, the incidence of HCC must be high in India. In fac...

Ngày tải lên: 12/08/2014, 04:20

... and of itself, can directly induce cytoplasmic lipid accumulation. Further studies examining the genotype 3 virus are warranted to further recognize the process involved in HCV-induced steatosis. ... USA Corresponding address: Ke-Qin Hu, MD, Director of Hepatology Services and Associate Professor of Clinical Medicine, Division of Gastroenterology, Univ. of California, Irvine...

Ngày tải lên: 02/11/2012, 09:51

... used in molecular epidemiology studies, where exact subtyping is needed. In clinical practice, HCV genotype can be determined by various commercial kits, using direct sequence analysis of the ... virological tools in the treatment of chronic hepatitis C, according to the HCV genotype: genotype 1 (A), genotypes 2 and 3 (B), and genotypes 4, 5 and 6 (C) . Int. J. Med...

Ngày tải lên: 02/11/2012, 09:56

... found in all patients infected with genotype C, with high frequency in patients infected with genotypes D, and at a very low fre- quency in genotype A-infected patients. The occurrence of this ... chronic hepatitis B virus carriers in Shanghai, China. Intervirology 2001, 44:43-47. 32. Mayerat C, Mantegani A, Frei PC: Does hepatitis B virus (HBV) genotype influence the...

Ngày tải lên: 12/08/2014, 04:20

... risk of HCV infection associated with non-injecting drugs is probably linked to the usual prac- tice of sharing of non-injecting drug implements, such as pipes and straws, for smoking and sniffing/snorting drugs, ... hepatitis B virus infection in truck drivers in Brazil, South America. Sex Transm Infect 2008, 84:386-389. 14. Ginabreda MGP, Yoshida CFT, Niel C: Genomic characte...

Ngày tải lên: 12/08/2014, 04:20

... chronic HCV infectionFigure 3 The specificity of anti-HCV antibody responses in patients suffering from chronic HCV infection. A. The fre- quency of antibodies against individual recombinant HCV ... the cases, while usually the infection becomes chronic. Within 20 to 30 years chronic HCV infection can progress to cirrhosis in 20% of the patients leading to hepatocellular carcinoma r...

Ngày tải lên: 12/08/2014, 04:21

... AB033555-Indonesia-(B) ATGAGTGGGAGGAGTTGGGGGAGGAGATCAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCATGTTCATGTCCTATTGTTCAAGCCTCCAAGCTGTGC DQ993709-Taiwan-(B) ... associated with HCC was low [40]. If BCP mutation is strongly associated with clinical out- come of liver disease including HCC, the incidence of HCC must be high in India. In fac...

Ngày tải lên: 12/08/2014, 04:20

... hepatocytes by induction of apop- tosis. In addition, CD4+ and CD8+ T-cells are involved in the inflammatory process as well as the destruction of these cells by directly inducing cytotoxic effects ... cells cultured in the presence or absence of tetracycline to induce specific protein expressionFigure 3 Different features of apoptosis induced by the HCV-core protein in UC cel...

Ngày tải lên: 12/08/2014, 04:21

... expression constructs NS4B FL Forward primer, GTGGGTACCATGTCACACCTCCCTTACATCGAACAG Reverse primer, TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B-CTD Forward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGC Reverse ... This indicates that membrane association is not affected by the suggested RNA binding characteristics of the domain in the presence of RNA. Clearly, the HCV life cycle is achieved...

Ngày tải lên: 12/08/2014, 04:21