Báo cáo y học: " Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression" ppsx
Báo cáo y học: " Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression" ppsx
... regulators that bind to thesesites might enhance the promoter activity of HHV -6 MIEp. Interestingly, the promoter construct that con-tained introns 1 and 2 was less active than the promoter containing ... activity i n Jurkat,Motl-3,andSupT 1cells, suggestingthattheHHV -6 MIE promoter has higher activity than the CMV promo-ter in certain cells, especially in T cells. This property ofthe H HV -6 ... NF-B-bindingsite. The activity of a mutant HHV -6 MIEp, with theNF-B-binding site deleted, was dramatically decreased,indicating that the NF-B-binding site is critical for the promoter activity...
- 9
- 227
- 0
Báo cáo y học: " Human herpesvirus 6 infection impairs Toll-like receptor signaling" pptx
... their phosphorylation, which results in con-formational change and kinase activity [20-22]. It is alsonoteworthy that impaired cytokine production is notrestricted in the TLR4 system but is ... previouslyreported that HHV -6 infection mediates apoptosis in HHV -6- uninfected T cells through a bystander effectFigure 2 Downregulation of cytokine production by stimulation with TLR ligand in DCs ... detected in thesignal pathways of other TLRs. Therefore, these findingssuggest that impairment of TLR4 signaling in HHV -6- infected DCs is due to blocking not upstream, but down-stream in the...
- 5
- 185
- 0
Báo cáo y học: " Human herpesvirus-8 in northwestern China: epidemiology and characterization among blood donors" pdf
... in Xinjiang for genera-tions,andthattheyhaveuniqueculturalpractices.Anintriguing possibility is that different cultural practicesor social behaviors may play a part in HHV-8 infection.Alternatively, ... blood transfusion in future studies is essential.MethodsEthical approval of the study protocolThe present study was approved by the InstitutionalEthics Committee of the First Teaching Hospital ... rote and collected thequestionnaire. BH drafted the manuscript. KL participated in the design ofthe study and carried out statistical analyses.HW conceived the study, and participated in its...
- 7
- 213
- 0
Báo cáo khoa học: "Human herpesvirus 6 envelope components enriched in lipid rafts: evidence for virion-associated lipid rafts" pptx
... with stronger signal in HHV -6- infected cells. They may be migrated into raft fractions after infection.These results showed that non-raft proteins could bemigrated into raft fractions after infection, ... microdomainsmay provide a cellular location for HHV -6 assembly in infected cells. Interestingly, in mock-infected HSB-2 cells, CD59 and LAT proteins, which are concentrated in lipid rafts weretightly ... examined by analysis of viral DNA with PCRusing primer pair, AgB2232F (5'-acacctagtgttaaggatgttg) and AgBR (5'-tcacgcttcttctacatttac), which could amplifyHHV-6A glycoprotein B gene. Antibodies...
- 7
- 234
- 0
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... 2 76 Antisense: CTGCAAATGAGACACTTTCTCPPARγSense: TGAATGTGAAGCCCATTGAA 1,4 76 1 ,63 6 161 Antisense: CTGCAGTAGCTGCACGTGTTCartilage-specific genesAGN Sense: TGCGGGTCAACAGTGCCTATC 65 5–8 36 182Antisense: ... enhancement. [ 36] . To address this issue, weare currently analyzing the levels of pro-inflammatory cytokine in T- MPC culture medium. In support of our theory that expo-sure to pro-inflammatory cytokines ... not only eliminates tissue-plastic adher-ent inflammatory cells (monocytes), but also aids in reducingpro-inflammatory cytokine production by cells outside theiroriginal environment that might...
- 12
- 359
- 0
Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot
... cholesterol and raft-targeted proteins. Thisparticular lipid and protein composition is thought tofacilitate protein-protein interactions to create microdo-mains with distinct biological properties. ... Nefdetermines its ability to enhance virion infectivity. An early report demonstrated that this Nef activity dependson raft integrity of the producer cell and suggested this toreflect the Nef-mediated ... delayed early postinfection (Fig. 1B). Thus, Nef robustly enhances the infec-tivity of virions produced in MT-4 cells and DRM associa-tion of the viral protein is not limiting for this activity. Nef...
- 12
- 384
- 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... orchestrationof tumor angiogenesis and metastatic growth, suggestingantiangiogenic therapy as an attractive approach for anticancer treatment. In this context, activation of themitogen-activated ... with cell linesderived from the primary tumor. The finding that thetreatment with c-myc antisense oligodeoxynucleotidesabrogated cisplatin resistance and induced apoptosis in ametastatic lymph ... The finding thatNAMI-A completely inhibited PMA-induced ERK1/2activation and activity and totally counteracted phorbolester-primed c-myc gene expression heavily suggests that theinhibitory...
- 10
- 703
- 0
Báo cáo y học: "Hereditary angioedema: beyond international consensus - circa December 2010 - The Canadian Society of Allergy and Clinical Immunology Dr. David McCourtie Lecture" pps
... term prophylaxis is defined as any prophylaxisintervention intended to protect against an angioedemaevent with the intent of discontinuing prophylaxis oncethe indication for prophylaxis has passed. ... security areas, and outlininginstructions for administration of intervention therapy(such as infusion of pdC1INH, rhC1INH, bradykinin B2rec eptor antagonist, or kallikrein inhibitor). It is recom-mended ... with Untreated attacks typi-cally last over 48 to 96 hours. Attack triggers mayinclude puberty, estrogen-containing contraceptives,hormone replacement therapy, menstruation, pregnancy,stress,...
- 14
- 698
- 0
Báo cáo y học: "Use of HLA-B27 tetramers to identify low-frequency antigen-specific T cells in Chlamydia-triggered reactive arthritis" docx
... labelled streptavidin that specificallybind with high avidity to T cell receptors. In comparison withintracellular cytokine staining, the major advantage oftetramer technology is the identification ... staining in patient no. 6HLA-B27/Chlamydia peptide tetramer staining and intracellular cytokine staining in patient no. 6. When synovial T cells where stained with HLA-B27 Chlamydia peptide tetramers, ... Chlamydia-specific CD8+ T cells in these patients is low in synovial fluid and absent in peripheral blood with both methods (tetramer staining and intracellular cytokine staining), we investigated...
- 14
- 343
- 0
Báo cáo y học: "TNF inhibits production of stromal cell-derived factor 1 by bone stromal cells and increases osteoclast precursor mobilization from bone marrow to peripheral blood" ppt
... 1c,right panel). These findings suggest that both nonmigrated and SDF-1 migrated cells can differentiate into osteoclasts butthat CXCR4-positive cells have more osteoclast formingpotency.To study ... bonemarrow cavity in chronic inflammatory arthritis.IntroductionTNF is a clinically validated etiological factor in inflammatory-erosive arthritis and is known to synergize with RANKL and macrophage ... they have no competing interests.Authors' contributionsLX had full access to all data in the study and takes responsi-bility for the integrity of the data and the accuracy of the dataanalysis....
- 10
- 386
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP