Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps
... identity and 66-70% amino acid identity was found between the < /b> NS1 proteins. The < /b> NS allele A is more common and is the < /b> only subtype found in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ , resulting a product of 550 bp; and b- actin for...
Ngày tải lên: 11/08/2014, 21:21
... homozygous E4/4 phe- notypes [18] may be due to < /b> the < /b> inability of apoE4 to < /b> bind and initiate the < /b> clearance of small lipoproteins in < /b> plasma. In < /b> contrast, the < /b> observation that chylomicron remnants are cleared ... that apoE3 and apoE4, though possessing a similar apparent binding affinity (K d ) for the < /b> large lipid particles, are notabl...
Ngày tải lên: 08/03/2014, 09:20
... (a1 ,3-man) 2 preferen- tially bind to < /b> GNA but not GNA maize whereas GlcNAcß1,2Man and GlcNAcb1,2Mana1,3(GlcNAcb1,2- Mana1,6) Manb1,4GlcNAcb1,4GlcNAc were able to < /b> bind to < /b> GNA maize but not to < /b> GNA. We found a slightly ... not influence the < /b> additional binding of GNA to < /b> gp120. Taking into account the < /b> lectin-gp120 affinity data (Table 6) it c...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
... writing. SA collected samples, epidemiological data, perform all molecular biology assays and analyzed the < /b> data statistically. MA,ZA, BK, MA, ZF, SB and AH participated in < /b> data analysis. All the < /b> ... subjected to < /b> IFN alpha and Ribavirin combination therapy. Table 1 PePHD amino acid substitutions in < /b> base line samples of break through responders to < /b>...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Alterations in the muscle-to-capillary interface in patients with different degrees of chronic obstructive pulmonary disease" pps
... or by com- puting the < /b> ratio between CAF and the < /b> area of the < /b> muscle fibre (CAFA). CAFA is a parameter based on the < /b> diffu- sion distance between the < /b> capillary and the < /b> centre of the < /b> fibre. Capillary ... of capillaries around the < /b> fibre and the < /b> sharing factor (SF) for each fibre and thereafter calculating the < /b> sum o...
Ngày tải lên: 12/08/2014, 11:22
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... eliminate a hypothetical second site have been made here for the < /b> bacterial enzyme by stripping subunits III and IV off the < /b> native complex, and by further destroying a large part of the < /b> acidic lobe(s) ... oxidase from Paracoccus denitrificans. Nature 376, 660–669. 12. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashi...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt
... Research article Differences < /b> in < /b> the < /b> way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression Ian Conlon and Martin Raff Address: MRC Laboratory for Molecular Cell ... size, and that they therefore do not require cell-size checkpoints to < /b> maintain a constant size distribution as they proliferate. Do large and small Schwa...
Ngày tải lên: 06/08/2014, 18:20
Báo cáo khoa học: "Differences in the serum immunoglobulin concentrations between dairy and beef calves from birth to 14 days of age" pdf
... [2]. These absorbed Igs protect against systemic invasion by microorganisms and septic disease during the < /b> neonatal period. Unabsorbed Igs and Igs re-secreted back into the < /b> gut play an important role in < /b> ... Igs by the < /b> calf. Under normal conditions complete loss of the < /b> ability < /b> to < /b> absorb Ig occurs by 24-36 hours after birth in < /b> calves a...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo y học: Advances in the Surgical Management of Chronic Rhinosinusitis" pot
... 1980s 6 and has become the < /b> widespread standard of care. From a technical perspective, there has been the < /b> realization that meticulous handling of sinonasal mucosa results in < /b> a better and more rapid ... removal of ethmoid par- titions and other thin areas of bone. Various blades can be used in < /b> the < /b> ethmoid sinus, maxil- lary sinus, and frontal re...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "Alterations in the complement cascade in post-traumatic stress disorder" potx
... immunoregulatory mechanisms. Activa- tion of the < /b> complement through classical, alternative or lectin pathways generates opsonins, anaphylatoxins, and chemotaxins, mediators of inflammation and apoptosis [18-20]. ... classical pathway, hypoactivation state of the < /b> complement alternative pathway and overac- tivation of the < /b> complement terminal pathway; 2. Alterations i...
Ngày tải lên: 08/08/2014, 21:20