Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc
Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc
... this article as: Zhao et al.: Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR. Virology Journal 20 10 7:374.Submit your next manuscript to BioMed Centraland take ... 7:374http://www.virologyj.com/content/7/1/374Page 5 of 5SHOR T REPOR T Open Access Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCRKai Zhao1,3, Fangting Han4, Yong Zou 2, 3, Lianlong Zhu1,3, Chunhua ... dTTP, dCTP and dGTP, 1 .25 U DNA polymerase,2mMMgCl 2 (TaKaRa, Dalian, China), 20 0 nM of eachprimer, and different quantities of the plasmid DNAtemplates. Amplifications were programmed as follows:onestepof94°Cfor5min,30cyclesof94°Cfor30s,60°C...
- 5
- 389
- 0
Báo cáo y học: " Molecular characterization of porcine circovirus 2 isolated from diseased pigs co-infected with porcine reproductive and respiratory syndrome virus" pot
... identification of immunorelevantepitopes. J GenVirol 20 00, 81:1815-1 824 .16. Larochelle R, Magar R, D’Allaire S: Genetic characterization andphylogenetic analysis of porcine circovirus type 2 (PCV2) ... Sciences, Shanghai Academy of Agricultural Sciences, 29 01 Beidi Road, Shanghai 20 1106, PR ChinaYi and Liu Virology Journal 20 10, 7 :28 6http://www.virologyj.com/content/7/1 /28 6© 20 10 Yi and Li u; ... Emergence of fatal PRRSV variants:Unparalleled outbreaks of atypical PRRS in china and moleculardissection of the unique hallmark. PLoS ONE 20 07, 6:e 526 .14. Allan GM, Kennedy S, McNeilly F, Foster...
- 4
- 334
- 0
Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx
... 539 21 -nt AAGGAACTATAGTATGGCGAA B3 Backward outer 707 724 18-nt CTGTTGCTGGTCTCTTGT Forward inner 5 92 616 46-mer(F1c :25 -nt, TGGACCTACAAATTGCACCAATATA- FIP (F1c + F2) 548 568 F2 :21 -nt) ACCTCTTACAGTTGCAAAGTG ... ACCTCTTACAGTTGCAAAGTG Backward 619 640 44-mer (B1c :22 -nt, AAGGACCCAGAGTGATGAGGTA- BIP inner(B1c + B2) 679 700 B2 :22 -nt) TGTATTTTCTTCCTTGGAACTT LF Loop Forward 569 591 23 -nt CTCTTAGCTGCTAGTTCTGAAGC ... Email: a5 121 56093@qq.com Aff1 Chongqing Academy of Animal Science, Chongqing 4 024 60, China Aff2 Rongchang Bureau of Animal Husbandry, Chongqing 4 024 60, China Abstract Background Sacbrood...
- 9
- 266
- 0
Báo cáo y học: "Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants" ppsx
... representative ‘early branching’protists (Excavata: Giardia lamblia, Trichomonas vagina-lis, Trypanosoma brucei and Leishmania major; Chromal-veolata: Plasmodium falciparum and Phaeodactylumtricornutum; ... Proof and evolutionary analysis of ancientgenome duplication in the yeast Saccharomyces cerevisiae. Nature 20 04, 428 :617- 624 . 12. Bowers JE, Chapman BA, Rong J, Paterson AH: Unravelling angiospermgenome ... of plants and ani-mals/fungi could have been as early as the separation of any major groups of extant eukaryotes. Hence, geneduplications prior to t he split of plants and animals/fungi can...
- 13
- 384
- 0
Báo cáo y học: "Systematic detection of putative tumor suppressor genes through the combined use of exome and transcriptome sequencin" ppt
... 47:460-464. 52. Shivapurkar N, Toyooka S, Toyooka KO, Reddy J, Miyajima K, Suzuki M,Shigematsu H, Takahashi T, Parikh G, Pass HI, Chaudhary PM, Gazdar AF:Aberrant methylation of trail decoy receptor ... colorectal cancers. Hepatogastroenterology 20 09,56:16 42- 1644. 42. Hibi K, Sakata M, Yokomizo K, Kitamura YH, Sakuraba K, Shirahata A, Goto T,Mizukami H, Saito M, Ishibashi K, Kigawa G, Nemoto H, Sanada ... Nat RevCancer 20 04, 4:665-676.44. Haugen AC, Goel A, Yamada K, Marra G, Nguyen TP, Nagasaka T,Kanazawa S, Koike J, Kikuchi Y, Zhong X, Arita M, Shibuya K, Oshimura M,Hemmi H, Boland CR, Koi...
- 14
- 380
- 0
Báo cáo y học: "Effective detection of rare variants in pooled DNA samples using Cross-pool tailcurve analysis" ppsx
... defined as the average quality of all base calls for a variant, and (4) tailcurve ratio, a metric that captures strand-specific tailcurve profiles that are characteristic of falsely called variants. ... distribution of average qualities analyzed, SERVIC4E again uses cluster analysis to separate and retain the highest quality variants from the rest of the data. Alternatively, if the automated clustering ... Amplification of Large Sets of Human Exons. Nat Methods 20 07, 4:931-936. 12. Markoulatos P, Siafakas N, Moncany M: Multiplex Polymerase Chain Reaction: A Practical Approach. J Clin Lab Anal 20 02, 16:47-51....
- 51
- 410
- 0
Báo cáo y học: "Rapid recovery of serratus anterior muscle function after microneurolysis of long thoracic nerve injury" pot
... left side and 12 on the right side. The average age of injury was 2. 9 years at the time of surgery, ranging from 2 months to 12 years. The onset is approximate as in somecases the symptoms were ... trunk,typically 15% 20 % of the thickness of the muscle. A demarcated area of compression was typically apparenttoward the point of exit of the long thoracic nerve fromthe middle scalene muscle, ... range of motion of theshoulder and neck was part of the immediate postopera-tive management, with a goal of full range of motion at orbeyond preoperative levels by the third day after surgery.Intraoperative...
- 8
- 225
- 0
Báo cáo y học: "Early Detection of cytokine protein expression in mouse lung homogenates using suspension bead array" ppt
... citation purposes)The alignment of the 22 analytes on the RayBio Mouse Cytokine Antibody ArrayFigure 2 The alignment of the 22 analytes on the RayBio Mouse Cytokine Antibody Array. Abbreviations: ... Charles Bisgaier for allocating technical resources to assist with performing the suspension bead array and antibody array assays and Walter Bobrowski for assisting with imaging of antibody arrays.Journal ... JC participated in protein isolation, suspensionbead array assays and created the associated data charts.RS peer-reviewed the data interpretations. All authors readand approved the final manuscript.AcknowledgementsWe...
- 9
- 358
- 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot
... loadingMaria Salskov-Iversen1, Carole L Berger* 2 and Richard L Edelson 2 Address: 1Department of Immunology, AArhus University, Aarhus, Denmark and 2 Department of Dermatology, Yale University, ... methodology, demonstrated a signifi-cantly enhanced stimulatory capacity in mixed leukocyteculture and the ability to promote CD8 T cell expansionand cytolytic capacity.Therefore, this approach yields ... become activatedand assume the phenotype of immature DC. This mono-cyte-to-DC transition can be preserved by phagocytosis of particulate material such as zymosan [7]. We have alsopreviously demonstrated...
- 16
- 251
- 0
Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx
... 1Wadsworth Center, New York State Department of Health, Biodefense Laboratory, Albany, NY, USA, 2 SUNY at Albany, School of Public Health, Department of Biomedical Sciences, Albany, NY, USA, ... A, Dadachova E, Pirofski LA: Passive antibody therapyfor infectious diseases. Nat Rev Microbiol 20 04, 2: 695-703.7. Casadevall A: Passive antibody administration (immediateimmunity) as a specific ... byPEHRG214, a novel caprine anti-HIV-1 polyclonal antibody.AIDS 20 06, 20 :505-515. 22 . Ahuja N, Kumar P, Bhatnagar R: Rapid purification of recom-binant anthrax-protective antigen under nondenaturing...
- 8
- 312
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam