Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc

Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc

Báo cáo y học: " Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR" doc

... this article as: Zhao et al.: Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR. Virology Journal 20 10 7:374. Submit your next manuscript to BioMed Central and take ... 7:374 http://www.virologyj.com/content/7/1/374 Page 5 of 5 SHOR T REPOR T Open Access Rapid detection of porcine circovirus type 2 using a TaqMan-based...

Ngày tải lên: 11/08/2014, 21:21

5 389 0
Báo cáo y học: " Molecular characterization of porcine circovirus 2 isolated from diseased pigs co-infected with porcine reproductive and respiratory syndrome virus" pot

Báo cáo y học: " Molecular characterization of porcine circovirus 2 isolated from diseased pigs co-infected with porcine reproductive and respiratory syndrome virus" pot

... identification of immunorelevant epitopes. J GenVirol 20 00, 81:1815-1 824 . 16. Larochelle R, Magar R, D’Allaire S: Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) ... Sciences, Shanghai Academy of Agricultural Sciences, 29 01 Beidi Road, Shanghai 20 1106, PR China Yi and Liu Virology Journal 20 10, 7 :28 6 http://www.virologyj.com/con...

Ngày tải lên: 12/08/2014, 01:22

4 335 0
Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx

Báo cáo hóa học: "Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay" pptx

... 539 21 -nt AAGGAACTATAGTATGGCGAA B3 Backward outer 707 724 18-nt CTGTTGCTGGTCTCTTGT Forward inner 5 92 616 46-mer(F1c :25 -nt, TGGACCTACAAATTGCACCAATATA- FIP (F1c + F2) 548 568 F2 :21 -nt) ACCTCTTACAGTTGCAAAGTG ... ACCTCTTACAGTTGCAAAGTG Backward 619 640 44-mer (B1c :22 -nt, AAGGACCCAGAGTGATGAGGTA- BIP inner(B1c + B2) 679 700 B2 :22 -nt) TGTATTTTCTTCCTTGGAACTT LF Loop Forward 569 59...

Ngày tải lên: 21/06/2014, 19:20

9 266 0
Báo cáo y học: "Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants" ppsx

Báo cáo y học: "Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants" ppsx

... representative ‘early branching’ protists (Excavata: Giardia lamblia, Trichomonas vagina- lis, Trypanosoma brucei and Leishmania major; Chromal- veolata: Plasmodium falciparum and Phaeodactylum tricornutum; ... Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 20 04, 428 :617- 624 . 12. Bowers JE, Chapman BA, Rong J, Paterson AH:...

Ngày tải lên: 09/08/2014, 20:21

13 384 0
Báo cáo y học: "Systematic detection of putative tumor suppressor genes through the combined use of exome and transcriptome sequencin" ppt

Báo cáo y học: "Systematic detection of putative tumor suppressor genes through the combined use of exome and transcriptome sequencin" ppt

... 47:460-464. 52. Shivapurkar N, Toyooka S, Toyooka KO, Reddy J, Miyajima K, Suzuki M, Shigematsu H, Takahashi T, Parikh G, Pass HI, Chaudhary PM, Gazdar AF: Aberrant methylation of trail decoy receptor ... colorectal cancers. Hepatogastroenterology 20 09, 56:16 42- 1644. 42. Hibi K, Sakata M, Yokomizo K, Kitamura YH, Sakuraba K, Shirahata A, Goto T, Mizukami H, Saito M, Ishibashi K, Kiga...

Ngày tải lên: 09/08/2014, 22:23

14 380 0
Báo cáo y học: "Effective detection of rare variants in pooled DNA samples using Cross-pool tailcurve analysis" ppsx

Báo cáo y học: "Effective detection of rare variants in pooled DNA samples using Cross-pool tailcurve analysis" ppsx

... defined as the average quality of all base calls for a variant, and (4) tailcurve ratio, a metric that captures strand-specific tailcurve profiles that are characteristic of falsely called variants. ... distribution of average qualities analyzed, SERVIC 4 E again uses cluster analysis to separate and retain the highest quality variants from the rest of the data. Alternatively,...

Ngày tải lên: 09/08/2014, 23:20

51 410 0
Báo cáo y học: "Rapid recovery of serratus anterior muscle function after microneurolysis of long thoracic nerve injury" pot

Báo cáo y học: "Rapid recovery of serratus anterior muscle function after microneurolysis of long thoracic nerve injury" pot

... left side and 12 on the right side. The average age of injury was 2. 9 years at the time of surgery, ranging from 2 months to 12 years. The onset is approximate as in some cases the symptoms were ... trunk, typically 15% 20 % of the thickness of the muscle. A demarcated area of compression was typically apparent toward the point of exit of the long thoracic nerve from the...

Ngày tải lên: 10/08/2014, 09:22

8 225 0
Báo cáo y học: "Early Detection of cytokine protein expression in mouse lung homogenates using suspension bead array" ppt

Báo cáo y học: "Early Detection of cytokine protein expression in mouse lung homogenates using suspension bead array" ppt

... citation purposes) The alignment of the 22 analytes on the RayBio Mouse Cytokine Antibody ArrayFigure 2 The alignment of the 22 analytes on the RayBio Mouse Cytokine Antibody Array. Abbreviations: ... Charles Bisgaier for allocating technical resources to assist with performing the suspension bead array and antibody array assays and Walter Bobrowski for assisting with imaging of a...

Ngày tải lên: 11/08/2014, 08:21

9 358 0
Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

Báo cáo y học: "Rapid construction of a dendritic cell vaccine through physical perturbation and apoptotic malignant T cell loading" pot

... loading Maria Salskov-Iversen 1 , Carole L Berger* 2 and Richard L Edelson 2 Address: 1 Department of Immunology, AArhus University, Aarhus, Denmark and 2 Department of Dermatology, Yale University, ... methodology, demonstrated a signifi- cantly enhanced stimulatory capacity in mixed leukocyte culture and the ability to promote CD8 T cell expansion and cytolytic capacity. Theref...

Ngày tải lên: 11/08/2014, 10:23

16 251 0
Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx

Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx

... 1 Wadsworth Center, New York State Department of Health, Biodefense Laboratory, Albany, NY, USA, 2 SUNY at Albany, School of Public Health, Department of Biomedical Sciences, Albany, NY, USA, ... A, Dadachova E, Pirofski LA: Passive antibody therapy for infectious diseases. Nat Rev Microbiol 20 04, 2: 695-703. 7. Casadevall A: Passive antibody administration (immediate immunity)...

Ngày tải lên: 11/08/2014, 10:23

8 312 0
w