báo cáo khoa học: " Piezoelectric-assisted removal of a benign fibrous histiocytoma of the mandible: An innovative technique for prevention of dentoalveolar nerve injury" pps

báo cáo khoa học: " Piezoelectric-assisted removal of a benign fibrous histiocytoma of the mandible: An innovative technique for prevention of dentoalveolar nerve injury" pps

báo cáo khoa học: " Piezoelectric-assisted removal of a benign fibrous histiocytoma of the mandible: An innovative technique for prevention of dentoalveolar nerve injury" pps

... fibrous histiocytoma of the mandible: An innovative technique for prevention of dentoalveolar nerve injury Maximilian EH Wagner 1† , Majeed Rana 1*† , Wolfgang Traenkenschuh 2 , Horst Kokemueller 1 , André ... Contributed equally 1 Department of Cranio-Maxillo-Facial Surgery, Hannover Medical School, Germany Full list of author information is available at the e...
Ngày tải lên : 11/08/2014, 20:21
  • 6
  • 333
  • 0
Báo cáo khoa học: "Soil CO in a beech forest: 2 efflux the contribution of root respiration Daniel" pptx

Báo cáo khoa học: "Soil CO in a beech forest: 2 efflux the contribution of root respiration Daniel" pptx

... would counterbalance underestimations on an annual basis. A TDR device (Trase system, Soil Moisture Equipment Corp., Santa Barbara, USA) was used for additional measurements of soil ... Respiration rates of plant organs and leaf and fine root turnover are as important as photosynthesis in deter- mining the ability of forest ecosystem to sequ...
Ngày tải lên : 08/08/2014, 14:21
  • 7
  • 368
  • 0
Báo cáo khoa học: "Surgical removal of stones in the stomach of a tiger shovelnose catfish" potx

Báo cáo khoa học: "Surgical removal of stones in the stomach of a tiger shovelnose catfish" potx

... anesthesia was also used in maintaining anesthesia with diluting to one ml isoflurane per gallon of water with isoflurane and was pumped up from the vat to the fishs oral cavity, over the gills and backed ... the fish was induced, it was transferred to the table, where three tubes for maintaining anesthesia were placed in both mouth and gills. The water with isoflurane used in...
Ngày tải lên : 07/08/2014, 18:20
  • 3
  • 403
  • 0
Báo cáo khoa hoc:" Successful removal of a telephone cable, a foreign body through the urethra into the bladder: a case report" pps

Báo cáo khoa hoc:" Successful removal of a telephone cable, a foreign body through the urethra into the bladder: a case report" pps

... the manuscript. AH was involved in the literature review and drafting of the manuscript. SM was involved directly in the treatment of the patient and assisted in the preparation of the manuscript. DTLT ... Van Ophoven A, DeKernion JB: Clinical management of foreign bodies of the genitourinary tract. J Urol 2000, 164(2):274-87. 3. Garcia Riestra V, Vareal Salgado M,...
Ngày tải lên : 11/08/2014, 10:22
  • 3
  • 286
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... (RSC-09-245-01-DMC) from the American Can- cer Society and by NIH grant number R01CA140522 from the National Cancer Institute (to MSC). We thank Venkat Dharmarajan for a critical reading of this manuscript. ... lysine methyltransferases. J Biol Chem 280, 5563–5570. 53 Qian C, Wang X, Manzur K, Sachchidanand, Farooq A, Zeng L, Wang R & Zhou MM (2006) Structural insights of th...
Ngày tải lên : 16/02/2014, 14:20
  • 11
  • 761
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... before an apparent increase in absorbance of 0.1 was recorded. The addition of PDI to the assay accelerated the reduc- tion and precipitation of the B-chain significantly, decreasing the lag-phase ... insulin was analyzed in the pres- ence of the PDI a domain and DsbA, which are capable of catalyzing the oxidation and reduction reac- tions, but lack the independ...
Ngày tải lên : 16/02/2014, 14:20
  • 9
  • 620
  • 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... important than full struc- tural characterization of the protein. Its quantitative analysis by the bottom-up method under normal and abnormal conditions can then provide a direct indica- tion of the ... Neil Kelleher, Harold Scheraga and Klaas van Wyck for valuable discussions, and the General Medical Institute of the National Institutes of Health, GM16609, for generou...
Ngày tải lên : 18/02/2014, 16:20
  • 13
  • 572
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, containing ... pattern. By coregulating PK and LDH cells can maintain homolactic fermenta- tion. The fact that the effects...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: "Topological Dependency Trees: A Constraint-Based Account of Linear Precedence" ppt

Tài liệu Báo cáo khoa học: "Topological Dependency Trees: A Constraint-Based Account of Linear Precedence" ppt

... substantiated in fu- ture research. Characteristic of our approach is that the for- mal presentation defines valid analyses as the so- lutions of a constraint satisfaction problem which is amenable ... their argument to appear in canonical (or coherent) position. (26) (dass) (that) Maria Maria einen a Mann man zu to lieben love scheint seems (that) Maria seems to love a man (27...
Ngày tải lên : 20/02/2014, 18:20
  • 8
  • 353
  • 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢. Western blot Cells were rinsed in NaCl ⁄ P i , trypsinized and ... and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢- TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCC...
Ngày tải lên : 06/03/2014, 09:22
  • 13
  • 503
  • 0