báo cáo khoa học: " Occlusal adjustment using the bite plate-induced occlusal position as a reference position for temporomandibular disorders: a pilot study" ppsx

Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf

Tài liệu Báo cáo khoa học: "Event Matching Using the Transitive Closure of Dependency Relations" pdf

... re- trieval using dependency relations. In SIGIR 2005, Salvador, Brazil, August. Radu Florian, Hani Hassan, Abraham Ittycheriah, Hongyan Jing, Nanda Kambhatla, Xiaoqiang Luo, Nicholas Nicolov, and Salim ... resignation of Khaddam was abrupt” as an example. In particular, the “depth” features at- tempt to capture the “importance” the dependency match, as measured by the depth of...

Ngày tải lên: 20/02/2014, 09:20

4 392 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

... TA CATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeI fl-SpsB3 TA GAATTCTTAATTTTTAGTATTTTCAGG EcoRI tr-SpsB5 TA CATATGCACCATCACCATCACCATATTGTTACACCATATA NdeI pIsaA5 TA CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC ... TA CCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoI IsaA3Myc TA GAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRI Rao C. V. S. et al. S. aureus type I sign...

Ngày tải lên: 07/03/2014, 01:20

13 464 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... the Quikchange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) with forward primer 5¢-GAAACGATGC ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA TCGTTTC-3¢. ... the asymmetric unit, and the glutamate-binding modes are identical to each other (Fig. 2A) . The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of...

Ngày tải lên: 22/03/2014, 21:20

10 375 0
Báo cáo khoa học: "Quantitative modeling of the neural representation of adjective-noun phrases to account for fMRI activation" doc

Báo cáo khoa học: "Quantitative modeling of the neural representation of adjective-noun phrases to account for fMRI activation" doc

... assumes that the meaning of the composition is the same as the adjective: u p = The noun model assumes that the meaning of the composition is the same as the noun: v p = The adjective ... exemplars the par- ticipant was viewing and thinking about. Sepa- rate classifiers were also trained for classifying the isolated nouns, the phrases, and the 4...

Ngày tải lên: 30/03/2014, 23:20

9 270 0
báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf

báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf

... surrounding edema area. On the T1-weighted image after the administration of contrast material (b and c), the mass has an inhomogeneous enhancement. Sagittal T1- weighted MR image without contrast (d) ... presentation of IACNS [7]. Less common complaints are aphasia, transient ischemic a ttack, ataxia, dysphasia, nausea or vomiting, loss of memory, seizure disorder, dyslalia, hypomnes...

Ngày tải lên: 09/08/2014, 02:20

4 333 0
Báo cáo khoa học: " JC virus in the pathogenesis of colorectal cancer, an etiological agent or another component in a multistep process?" pdf

Báo cáo khoa học: " JC virus in the pathogenesis of colorectal cancer, an etiological agent or another component in a multistep process?" pdf

... in a broad range of human tumors of glial and non-glial origin, including gliomas, ependymomas and medullo- blastomas, as well as in several non-neural clinical speci- mens of upper and lower gastrointestinal ... geographical areas, or if there a re particular strains more strongly associated to carcinomas. JCV DNA in normal, benign and malignant colorectal lesions JCV DNA sequences a...

Ngày tải lên: 12/08/2014, 04:21

8 400 0
báo cáo khoa học: "Influence of viral hepatitis status on prognosis in patients undergoing hepatic resection for hepatocellular carcinoma: a meta-analysis of observational studies" ppt

báo cáo khoa học: "Influence of viral hepatitis status on prognosis in patients undergoing hepatic resection for hepatocellular carcinoma: a meta-analysis of observational studies" ppt

... experience and a systematic review. World J Surg Oncol 2010, 8:55. 49. Imamura H, Matsuyama Y, Tanaka E, Ohkubo T, Hasegawa K, Miyagawa S, Sugawara Y, Minagawa M, Takayama T, Kawasaki S, Makuuchi ... hepatocellular carcinoma; NBNC-HCC = no infection of HBV or HCV related hepatocellular carcinoma; AFP = alpha fetoprotein; ALT = alanine aminotransferase; AST = aspartate aminotransferase; T-Bi...

Ngày tải lên: 09/08/2014, 02:21

10 360 0
báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx

báo cáo khoa học: " An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development" docx

... phosphatase 2A (PP 2A) 65 KDa regulatory subunit A TCGTGATGCTGCTGCTAACAA/ TTGCCCAGTCAGGACCAAAT 62/1.90 SAND CF405409 AT2G28390.1 SAND family protein CAACATCCTTTACCCATTGACAGA/ GCATTTGATCCACTTGCAGATAAG 76/1.91 Sucrose ... † EC959059 AT5G60390.1 Elongation factor 1-alpha (other hits include AT1G07940.2, AT1G07940.1, AT1G07920.1, AT1G07930.1) GAACTGGGTGCTTGATAGGC/ AACCAAAATATCCGGAGTAAAAGA...

Ngày tải lên: 12/08/2014, 05:20

11 376 0
báo cáo khoa học: " Occlusal adjustment using the bite plate-induced occlusal position as a reference position for temporomandibular disorders: a pilot study" ppsx

báo cáo khoa học: " Occlusal adjustment using the bite plate-induced occlusal position as a reference position for temporomandibular disorders: a pilot study" ppsx

... relation to this reference position. Evi- dence-based occlusal adjustment was then performed based on the results of occlusal analysis. After the occlu- sal adjustment, the outcome was evaluated. ... performed the examination and made the diagnosis, and the treatment outcome was evaluated by the same denti st. Ano ther dentist fabricated the anterior bite plate fo...

Ngày tải lên: 11/08/2014, 20:20

8 208 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... only data corresponding to the first 6 h are shown. Comparing the data obtained for particular temperatures (Fig. 3), it can be seen that at 37 °C, the reaction was as fast at pH 2.5 as it was at ... can be completed in as little as 3 h at 70 °C (4 h after the addition of the exopeptidase). Preparative activation Activation of (Pyr)-ONC (M23L) was performed as described i...

Ngày tải lên: 19/02/2014, 12:20

9 705 0
w