báo cáo khoa học: " Efficacy and tolerability of intravenous methylergonovine in migraine female patients attending the emergency department: a pilot open-label study" pdf
báo cáo khoa học: " Efficacy and tolerability of intravenous methylergonovine in migraine female patients attending the emergency department: a pilot open-label study" pdf
... recorded at the same time points. Methyl-
ergonovine was administered intravenously diluted in 5
ml of saline at an initial dosage of 0.15 mg. If pain inten-
sity was still above 5 in pain VAS, an additional ... methylergonovine in
migraine female patients attending the emergency department: a
pilot open-label study
Alfredo I Niño-Maldonado
1
, Gary Caballero...
Báo cáo khoa học: "Efficacy and safety of a low-flow veno-venous carbon dioxide removal device: results of an experimental study in adult sheep" pps
... of data,
and manuscript drafting. GB performed study conception and
design, statistical analysis and interpretation of data, and revi-
sion of manuscript. All authors read and approved the final
manuscript.
Acknowledgements
The ... Mariella Maio
1
, Enrica Ferretti
1
, Annalisa Longobardo
1
, Raffaele Potenza
1
,
Luca Rivalta
1
, Paola Selvaggi
1
, Marco Vergano
1
and...
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... 410–411.
28 Tagawa A, Mezzacasa, a. Hayer A, Longatti A,
Pelkmans L & Helenius A (2005) Assembly and traffick-
ing of caveolar domains in the cell: caveolae as stable,
cargo-triggered vesicular transporters. ... caveolae peaks were
analysed by SDS ⁄ PAGE and immunoblotting by loading equal
amounts of protein (lanes 1 and 4, VHD-caveolae; lanes 2 and 5,
HD-caveolae; l...
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... 5¢-ACAAGGG
TAGACCAAACACCAAGAACAGCAACAAAAGAG
ACGGGCGAATCACTGACCATCAACgccGTCCTGA
GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA
TGCGGTGCCAGCTCCCCAACTGTAATAAATACC
AGACAAATTATATGCTCCaacCCTATACGTGCCA
CTG-3¢); followed by secondary PCR using ... disulphide
minus variant of 12F-11 incorporating mutations Cys22Ala
and Cys82Val was constructed by overlapping PCR using
oligonucleotide primers N851...
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt
... in norma l and aberrant flowers. R eal-time RT-PCR analysis of the Actinidia
flowering genes in the leaf and floral organs of A. deliciosa ’Hayward’ (female, normal), ‘Chieftain’ (male, normal) ... Mark McNeilage for help with the A. deliciosa
’Pukekohe dwarf’ mutant, Lekha Sreekantan for involvement in early stages
of the project, Andrew Gleave, Sakuntala Karunairet...
báo cáo khoa học: " Bioaccumulation and toxicity of selenium compounds in the green alga Scenedesmus quadricauda" pps
... than selenate. This was probably
due to an increase of a selenomethionine (29% of SeMet
in the case of selenate and 41% of SeMet in the case of
selenite). The increasing toxicity was also accompanied ... Selenite and selenate differ greatly in
the ease of assimilation and xylem transport [45]. Selenate
assimilation follows, in principle, that of sulfate...
Báo cáo khoa học: " Prevalence and incidence of severe sepsis in Dutch intensive care unit" pdf
... the
prevalence, the estimated length of stay, and the capacity of the participating ICUs relative to the
national intensive care capacity.
Results The participating ICUs had 442 beds available for admissions, ... hospital
admissions and 11% in all ICU admissions [15].
Annual incidence based on the incidence series of cases
A second estimate of the annual incide...
Báo cáo khoa học: "An ultrasonographic evaluation of skin thickness in breast cancer patients after postmastectomy radiation therapy" docx
... covering the axil-
lary and the infra -and s upra-clavicular areas for all
patients. The total dose was 46-50 Gy administered in
daily doses of 2 Gy 5 days a week using a Siemens Pri-
mus, linear accelerator ... who
gave guidance on the study and participated in the writing and revision of
the manuscript. All authors have read and approved the final manuscr...
