báo cáo khoa học: " Efficacy and tolerability of intravenous methylergonovine in migraine female patients attending the emergency department: a pilot open-label study" pdf

... recorded at the same time points. Methyl- ergonovine was administered intravenously diluted in 5 ml of saline at an initial dosage of 0.15 mg. If pain inten- sity was still above 5 in pain VAS, an additional ... methylergonovine in migraine female patients attending the emergency department: a pilot open-label study Alfredo I Niño-Maldonado 1 , Gary Caballero...

Ngày tải lên: 11/08/2014, 20:20

... of data, and manuscript drafting. GB performed study conception and design, statistical analysis and interpretation of data, and revi- sion of manuscript. All authors read and approved the final manuscript. Acknowledgements The ... Mariella Maio 1 , Enrica Ferretti 1 , Annalisa Longobardo 1 , Raffaele Potenza 1 , Luca Rivalta 1 , Paola Selvaggi 1 , Marco Vergano 1 and...

Ngày tải lên: 13/08/2014, 03:20

... 410–411. 28 Tagawa A, Mezzacasa, a. Hayer A, Longatti A, Pelkmans L & Helenius A (2005) Assembly and traffick- ing of caveolar domains in the cell: caveolae as stable, cargo-triggered vesicular transporters. ... caveolae peaks were analysed by SDS ⁄ PAGE and immunoblotting by loading equal amounts of protein (lanes 1 and 4, VHD-caveolae; lanes 2 and 5, HD-caveolae; l...

Ngày tải lên: 16/03/2014, 13:20

... 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using ... disulphide minus variant of 12F-11 incorporating mutations Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotide primers N851...

Ngày tải lên: 17/03/2014, 10:20

...

Ngày tải lên: 07/08/2014, 20:23

... in norma l and aberrant flowers. R eal-time RT-PCR analysis of the Actinidia flowering genes in the leaf and floral organs of A. deliciosa ’Hayward’ (female, normal), ‘Chieftain’ (male, normal) ... Mark McNeilage for help with the A. deliciosa ’Pukekohe dwarf’ mutant, Lekha Sreekantan for involvement in early stages of the project, Andrew Gleave, Sakuntala Karunairet...

Ngày tải lên: 11/08/2014, 11:22

... than selenate. This was probably due to an increase of a selenomethionine (29% of SeMet in the case of selenate and 41% of SeMet in the case of selenite). The increasing toxicity was also accompanied ... Selenite and selenate differ greatly in the ease of assimilation and xylem transport [45]. Selenate assimilation follows, in principle, that of sulfate...

Ngày tải lên: 12/08/2014, 03:20

... the prevalence, the estimated length of stay, and the capacity of the participating ICUs relative to the national intensive care capacity. Results The participating ICUs had 442 beds available for admissions, ... hospital admissions and 11% in all ICU admissions [15]. Annual incidence based on the incidence series of cases A second estimate of the annual incide...

Ngày tải lên: 12/08/2014, 20:20

... covering the axil- lary and the infra -and s upra-clavicular areas for all patients. The total dose was 46-50 Gy administered in daily doses of 2 Gy 5 days a week using a Siemens Pri- mus, linear accelerator ... who gave guidance on the study and participated in the writing and revision of the manuscript. All authors have read and approved the final manuscr...

Ngày tải lên: 09/08/2014, 09:20

Ngày tải lên: 09/08/2014, 09:20