báo cáo khoa học: " Panorametry: suggestion of a method for mandibular measurements on panoramic radiographs" potx

... panorametry traced over a panoramic radiography with information for bilateral bone-dental angular measure-ments of the mandibleFigure 8 Image of panorametry traced over a panoramic radi- ography ... CML and ML. BioMed Central Open Access Page 1 of 9 (page number not for citation purposes) Head & Face Medicine Methodology Panorametry: suggestion of a method fo...

Ngày tải lên: 11/08/2014, 20:20

... albeit based on machine-learned models trained on French data. 4 Evaluation We performed a human evaluation of French generation. This was the first formal evaluation of the French generation system. ... (199 8a) "The practical value of n-grams in generation". In Proceedings of the 9th International Workshop on Natural Language Generation, Niagara -on- the-Lake, Ca...

Ngày tải lên: 31/03/2014, 20:20

... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology an...

Ngày tải lên: 18/02/2014, 11:20

... 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64- C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ and ... to the nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5 Kono M, Hayashi N & Samata T (2000) Molecular mechanism of the nacreous layer...

Ngày tải lên: 18/02/2014, 17:20

... the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The spectral ... GC, Katakura K, Tomita T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxyge...

Ngày tải lên: 19/02/2014, 05:20

... synchrotron beam time at the Synchrotron Radiation Source, Daresbury Laboratory, for data collection, and for preliminary crystal characterization at the European Synchrotron Radiation Facility, ... inter- action of C2-OH with Glu191 is essential, because the tautomerization step of the catalytic reaction requires a general acid to donate a proton to the C1 carbon of the 1,2-ene...

Ngày tải lên: 19/02/2014, 05:20

... pyridine chromogen method [12]. The purity of the sample was greater than 97%, based on MALDI-TOF mass spectrometry. Preparation of monoclonal antibodies MP8 was covalently attached to keyhole limpet hemo- cyanin ... 4962–4967. 12. Aron, J., Baldwin, D .A. , Marques, H.M., Pratt, J.M. & Adams, P .A. (1986) Hemes and hemoproteins 1: preparation and analysis of heme containing oc...

Ngày tải lên: 19/02/2014, 12:20

... the action of aminoferase. Biokhimia 12, 556–568 (in Russian). 2. Esaki, N., Nakayuma, T., Sawada, S., Tanaka, H. & Soda, K. (1985) Proton NMR studies of substrate hydrogen exchange reactions ... a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino ac id. The lability of the a- pr...

Ngày tải lên: 19/02/2014, 16:20

... side chain and carbonyl oxygen of Asp9, the side chains of Asp12, Gln13, Asp19, the car- bonyl oxygen of Asn21 and one water molecule in a pentagonal bipyramidal manner (Fig. 4A) . Sequence alignments ... 6, 501–523. 50 Feller G, Payan F, Theys F, Qian M, Haser R & Gerday C (1994) Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas halo...

Ngày tải lên: 19/02/2014, 16:20

... mitoDC- 81 alkylates mtDNA in mitochondria or cells. The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear. The local concentrations of mitoDC-81 and DNA, and ... Preparation of mitochondria from animal tissues and yeasts. In Subcellular components. Preparation and Fractionation (Birnie, G.D., ed.), pp. 77–91. Butterworths, London. 38. Gornall,...

Ngày tải lên: 20/02/2014, 11:20