báo cáo khoa học: " A new biphasic osteoinductive calcium composite material with a negative Zeta potential for bone augmentation" ppt
... homogenous bone with a regular Sinus floor augmentation with the biphasic calcium compos-ite materialFigure 4 Sinus floor augmentation with the biphasic calcium composite material. Head & Face Medicine ... Biomed Mater Res 2001, 57:366-373. 33. Teng NC, Nakamura S, Takagi Y, Yamashita Y, Ohgaki M, Yamashita K: A new approach to enhancement of bone formation by...
Ngày tải lên: 11/08/2014, 20:20
... peptide with apparent antinoci- ceptive activity. J Biol Chem 275, 32391–32397. 18 Sharpe IA, Gehrmann J, Loughnan ML, Thomas L, Adams DA, Atkins A, Palant E, Craik DJ, Adams DJ, Alewood PF et al. ... 273, 283–298. 12 Pearlman DA, Case DA, Caldwell DA, Ross WR, Cheatham TE, DeBolt S, Ferguson D, Seibel G & Kollman P (1995) AMBER, a computer program for applying molecular mechanics,...
Ngày tải lên: 30/03/2014, 09:20
...
Ngày tải lên: 07/08/2014, 17:22
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
... eir system for the control of mammalian T-cell proliferation is based on a platform of assembled RNA devices formed by a modular sensor (aptamer) and a gene-regulatory (hammer head ribozyme) ... applications, for in vivo diagnostic and therapeutic applications. Chen and colleagues have recently reported a signicant technological advance by producing an RNA modular device...
Ngày tải lên: 11/08/2014, 12:21
báo cáo khoa học: " Cytosolic N-terminal arginine-based signals together with a luminal signal target a type II membrane protein to the plant ER" ppsx
... CGGGGTACC CCATGAATGATCGTAGACCGCAAAGGAAACGCCCAAGTAAACGGAATCCGAAG-3' RXYLT35 GGACTAGT TGAAAACGACGATGAGTG FXYLT35' GCTCTAGA GCATGAGTAAACGGAATCCG RXYLT35' GGGGTACC TGAAAACGACGATGAGTG The BamHI, SpeI or KpnI ... sequence At glucosidase I as template RGCS150 GACTAGT ACACAAATGCCGCATAAC RGCS90 GACTAGT AAAAGGAGTGATAACCCT FΔ13GCS90/150 CGGGGTACC CCATGAAATCATCATCATTATCTCCC FR/L4 CGGGGTACC...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt
... Philadelphia, Pennsylva- nia, USA, July. Matt Post and Daniel Gildea. 2008. Parsers as language models for statistical machine translation. In Proceed- ings of AMTA. Sylvain Raybaud, Caroline Lavecchia, ... prediction ability, we present two ex- tensions to standard n-gram language mod- els in statistical machine translation: a back- ward language model that augments the con- ventional fo...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri docx
... primers used in the study. Name Sequence (5¢fi3¢) Description MP sense MP anti CCG GCTAGCG GAATTC ATGATGGTAATGCAAGCTCAGCATACT CCGG GAATTC GGAGGAGGACATAGCCCT Primers for amplification of the MP gene. ... movement of tobacco mosaic virus: enigmas and explanations. Mol Plant Pathol 1, 33–39. 30 Matsushita Y, Hanazawa K, Yoshioka K, Oguchi T, Kawakami S, Watanabe Y, Nishiguchi M & Nyunoya H (...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: " Evaluation of partial cranial cruciate ligament rupture with positive contrast computed tomographic arthrography in dogs" ppt
... femoral attachment (A) , and tibial attachment (I). The cranial cruciate ligament (black arrow) transverse images and caudal cruciate ligamen t sagittal images (white arrow) were clearly identified. ... initial transverse CTA image of the intact cranial cruciate ligament at the tibial attachment revealed a comma shape. The middle stage revealed a round shape. The final CTA transverse...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo khoa học: "Genetic transformation: short review of methods and their applications, results and perspectives for forest trees" ppt
... cells are in contact with the Agrobacterium and the transfer of T-DNA occurs. Then the agrobacteria are eliminated and the plant explants are transferred onto a regenera- tion ... al, 1992 ; Nilsson, 1992). Transgenic trees have also been reported for walnut via Agrobacteri- um transformation of somatic embryos (McGranahan et al, 1988, 1990 ; Jay-...
Ngày tải lên: 08/08/2014, 23:22
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf
... pylori CCUG17874 genomic DNA using the following primers: forward, 5¢-CACCAAACCTTATACGATTGATAAGGCA AAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCT TCTAG-3¢. The construct was cloned directly into the pET151 ... diffracts to a Table 1. Statistics on data collection and refinement. A wavelength of 0.8726 A ˚ was used. Rotations of 1° were performed. The Ramachan- dran plot was calculated using...
Ngày tải lên: 16/02/2014, 14:20