báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc

báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc

báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc

... using the Mann-Whitney U test, the adequate statistical values are the mean ranks and the sum of ranks. However, to improve the comparability of the obtained results, data are presented as means and ... with patients seeking care at the TMD/Orofacial Pain Outpa- tient Clinic (TMD/OFPOC) at the same university. We examined sociodemographic data, self-reported somatic c...

Ngày tải lên: 11/08/2014, 20:20

8 216 0
Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx

Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx

... (EBRT), brachytherapy (BRT), and intraoperative radiation ther- apy. Unfortunately, EBRT can cause growth retardation or adversely affect organ function in the pediatric popula- tion. Although randomized ... for citation purposes) Introduction A variety of radiotherapeutic approaches have been used in the adjuvant local management of soft tissue sarcoma (STS). These include external...

Ngày tải lên: 09/08/2014, 09:22

6 260 0
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"

... to emphasize what Streat and coworkers [15] termed, the large risk of unacceptable badness’, rather than a vanishingly small potential for benefit. There are far worse things than death, and many of ... of them occur in ICUs when futility maxims are circumvented. There is a population of ICU patients who will die no matter what treatment is rendered them. Medically inappropriate...

Ngày tải lên: 25/10/2012, 10:45

2 463 0
Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx

Tài liệu Báo cáo khoa học: Nucleolin/C23 mediates the antiapoptotic effect of heat shock protein 70 during oxidative stress pptx

... molecular basis for new therapeutic strate- gies targeting specific pathways to treat human heart disease. Materials and methods Animals Neonatal Wistar rats (1-3 days) were purchased from the Animal ... ª 2009 The Authors Journal compilation ª 2009 FEBS Statistical analyses Data are presented as mean ± standard error of the mean (SEM) of the values obtained from the indicated nu...

Ngày tải lên: 16/02/2014, 09:20

11 615 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx

Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx

... 2010 FEBS pantoate. The Nd atom of Asp152 is hydrogen-bonded via one water molecule to the O3 atom of pantoate, and via two water molecules to the O4 atom of panto- ate. The Ne atom of His37 is ... is capable of binding both pantoate and ATP, at equivalent sites in the dimer, which is the first step of the bicatalytic–unicatalytic–unicatalytic–bicata- lytic mechanis...

Ngày tải lên: 16/02/2014, 09:20

16 791 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 5′ 3′ UAAAUGUGAAU ACAAUGUGAAA GCUAAGAGUUA IL6R mRNA mut 3 IL6R mRNA mut 2 miR-2 3a miR-2 3a miR-2 3a 2531 ... 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACC...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

... molecule consists of a long, partially unsaturated, aliphatic backbone with spaced cyclic ethers and 64 chiral centers. Examination of the structure shows that there is, in fact, a group of different palytoxins, ... [7,8]. Italian coasts are not the only seawaters where Ostreopsis species have appear; they have been found in the waters around Spain and Greece as well, indicati...

Ngày tải lên: 18/02/2014, 14:20

8 691 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr D...

Ngày tải lên: 18/02/2014, 16:20

14 635 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

... incubation with cofilin at pH 8.0 the rate and the extent of actin cleavage was the same in the presence and absence of 30 mm Pi. On the other hand, at pH 6.5 the rate of F-actin cleavage was inhibited ... vicinity of the barbed end of the filament, pro- ducing an ATP or ADP–Pi cap at this end. Because of the presence of this cap at the barbed end th...

Ngày tải lên: 19/02/2014, 07:20

9 488 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... degradation pathway (Ganas and Brandsch, unpublished). Therefore, it is reasonable to assume that pAO1 encoded AO and SsaDH have evolved specifically for the catabolism of CH 3 -4-aminobutyrate produced ... Use 15¢-GAG GTG GAT CCG TGG GCC GCA-3¢ Forward mao, cloning 25¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ Reverse mao, cloning 35¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ Forward sad, cloning 45¢-CA...

Ngày tải lên: 19/02/2014, 07:20

9 525 0
Từ khóa:
w