báo cáo khoa học: " Epiglottis reshaping using CO2 laser: a minimally invasive technique and its potent applications" doc
... (acquired laryngomalacia) is an unusual cause of airway obstruction and a rare cause of obstructive sleep apnea syndrome (OSAS). We present a minimally invasive technique where epiglottis on cadaveric ... Central Page 1 of 4 (page number not for citation purposes) Head & Face Medicine Open Access Hypothesis Epiglottis reshaping using CO 2 laser: a minimally inva...
Ngày tải lên: 11/08/2014, 20:20
... phrase-based SMT, translation models and lan- guage models are automatically learned and/ or gen- eralised from the training data, and a translation is produced by maximising a weighted combination ... decide to mark up the input sentence if the translations of the marked phrases are accurate when taken contextual information into account. As large-scale manually annotated data is no...
Ngày tải lên: 07/03/2014, 22:20
... al. Acta vet. scand. vol. 47 no. 1, 2006 Statistical analysis Statistica 6.0 (Statsoft, 2001; Statsoft Scandi- navia AB, Uppsala, Sweden) was used for data analysis, and results are presented as means ... skin tempera- ture (Kameya and Yamaoka 1968, Webbon 1978). This variation was greater at an ambient temperature of 5 °C than at higher temperatures (15-25 °C) (Kameya and Yamaoka 1968,...
Ngày tải lên: 12/08/2014, 18:21
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... by plasmid pKIMP-UAUC. Random gene libraries are introduced into this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added ... Sokalski, W .A. , Hermann, J.C. & Mulholland, A. J. (2004) Transition state sta- bilization and substrate strain in enzyme catalysis: ab initio QM/MM modelling of the chorismate mutas...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx
... Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase Sabina Passamonti 1 , Alessandra Cocolo 1 , ... purchased from Sigma-Aldrich and Carlo Erba (Milan, Italy), and were of the highest available grade. Acknowledgements Thanks are due to Prof G.L. Sottocasa and Dr Anto- nella Bandiera (Un...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Molecular mechanisms regulating molting in a crustacean Halagowder Devaraj and Ayithan Natarajan ppt
... concentrations of Gas7 immunoreactivity only in early postmolt, maximum at late postmolt, and basal level in subse- quent stages. Values are expressed as mean ± SD (n ¼ 5). H. Devaraj and A. Natarajan ... D 1 stage. H. Devaraj and A. Natarajan Gas7 and the ERK1 ⁄ 2 signaling pathway in MIH expression FEBS Journal 273 (2006) 839–846 ª 2006 The Authors Journal compilation ª 2006 FEBS...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: The optimization of protein secondary structure determination with infrared and circular dichroism spectra docx
... normalization o f the band maximum to a constant intensity; normalization to a constant area; normalization of the combined amide I and II bands, with separate analyses of each band afterwards; and ... evaluating analysis performance Cross validation, as explained i n the M aterials and methods, treats each protein a s a n unknown and evaluates its structure using the rema...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: 14-3-3 Proteins regulate glycogen synthase 3b phosphorylation and inhibit cardiomyocyte hypertrophy doc
... probe: 5¢-ACCTAA AGCTGGGACCAGTAAAATCCACAGAAATTCACTCT TGCC-3¢; 18sRNA probe: 5¢-ACGGATTCTGATCGTCTT CGAACC-3¢. Western blot analysis Cells seeded on 30-mm plates were washed once with ice- cold NaCl ... 5¢-TC CTCTAGCAAGGAAGCCCATTCATGTGTATGGGGTC AACTGTTT-3¢; 14-3-3b probe: 5¢-GTCTATTGAGCTCT GTGATCTGTTTGGTGTCACTGTATCCTCCAC-3¢; 14-3-3c probe: 5¢-CAGGTGGACTGGCAGCGCACGCTGATGC TACTACTGCAGTCTTTA-3¢; 1...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx
... state-of-the-art abbreviation recognizers as baselines: Schwartz and Hearst’s method (SH) (2003), SaRAD (Adar, 2004), AL- ICE (Ao and Takagi, 2005), Chang and Sch ¨ utze’s method (CS) (Chang and ... var- ious methods by which to extract abbreviation definitions that appear in actual texts (Taghva and Gilbreth, 1999; Park and Byrd, 2001; Wren and Garner, 2002; Schwartz and Hears...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: "Sequential Labeling with Latent Variables: An Exact Inference Algorithm and Its Efficient Approximation" ppt
... models can be seen as a natural extension of CRF models, and CRF models can be seen as a special case of DPLVMs that employ only one latent variable for each label. To make the training and inference ... reported on a syntactic parsing task that DPLVM models can learn more compact and accurate grammars than the conventional tech- niques without latent variables. The effectiveness...
Ngày tải lên: 17/03/2014, 22:20