báo cáo khoa học: " "Tied together like a woven hat:" Protective pathways to Alaska native sobriety" pot

... brought us to the elders and let Heuristic Model of Alaska Native Protective PathwaysFigure 1 Heuristic Model of Alaska Native Protective Pathways Key. CC (community characteristics) Yuut cayarait includes ... Tlingit participants, participated in all analysis and interpreta- tion, and edited the paper. JA was a collaborating investi- gator involved in all aspects of data ga...

Ngày tải lên: 11/08/2014, 20:20

... are often affective in na- ture: we want to find a way of speaking about a topic that expresses a particular sentiment and car- ries a certain tone. However, affective categories are amongst the ... “as rich as a fat king”, something can be “as rich and enticing as a chocolate truffle”, a chocolate brownie”, a chocolate fruitcake”, and even a chocolate king”. The Jigsaw Bard...

Ngày tải lên: 07/03/2014, 22:20

... NRG-5¢_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. 2. Proteolytical processing of APP and NRG-1 in U373 ... NRG-jD_for NRG-TM_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC Approximately 200 (depending on isoform) Immunoglobulin domain (type I and II) NRG-IG_for NRG-TM_rev GCCAGGGAAGTCAGA...

Ngày tải lên: 16/03/2014, 04:20

... 2005) doi:10.1111/j.1742-4658.2005.04565.x Cytosolic phospholipase A 2 -a (cPLA 2 -a) is a calcium-activated enzyme that plays an important role in agonist-induced arachidonic acid release. In endothelial cells, free arachidonic acid can ... suggest that cPLA 2 -a and COX-2 may function together at a distinct and novel compartment for eicosanoid signalling. Abbreviations Con A,...

Ngày tải lên: 16/03/2014, 18:20

... m M KCl (lane 4) were analysed in a standard TUTase reaction with 1 lg total cellular RNA. Electrophoretic analysis of labeled RNA products in 6% polyacryl- amide gels and autoradiography were as before. Fig. ... substrate. The loaded material is indicated by ÔlÕ and labeled DNA used as a marker indicated (m). (B) EMSA with the same TUTase fractions as in (A) and T7-transcribed labeled U6...

Ngày tải lên: 17/03/2014, 09:20

... study a BMP-2 double mutant (A3 4D/ D5 3A) was evaluated in vivo. This variant features altera- tions of amino acids at position 34 and 53: alanine was substituted by aspartate and aspartate by alanine, ... evaluation of their biological activity, using ALP activity as a marker, revealed alterated effects for mutants of epitope 1 and epitope 2 as well. But only alterations of epitope 2 le...

Ngày tải lên: 11/08/2014, 20:20

... practice in description languages of binding a variable to a feature value with a scope larger than a single TFS — for example, in sharing structure between a daughter category and a mother category ... three features, and a three-clique for a feature graph. There are statistical refinements that one could additionally make, such as determining the empirical probability that...

Ngày tải lên: 08/03/2014, 07:20

... Gln15 and the carbonyl oxygen atoms of Asp11 and Asn23 (Fig. 3) in an arrangement similar to what is observed in VPRK. Both PRK and VPRK have calcium bound at Ca3. SPRK also has an aspar- tic acid ... subtilases is capable of accommodating at least six amino acid residues (P4–P2¢; notation according to Schechter and Berger [14]) of a polypeptide substrate or inhibitor [15], and both mai...

Ngày tải lên: 19/02/2014, 07:20

... from Biomol. Ac-DEVD-AMC is a substrate for caspases 3 and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and ... using a PSI - BLAST search [39]. Paracaspase could be a candidate gene for KIPase although no caspase activity from its product has been reported to date [39]. An alternati...

Ngày tải lên: 19/02/2014, 13:20

... mother liquor as cryoprotectant on a Rigaku Micromax 007 rotating anode generator (Rigaku- MSC, TX ⁄ USA) operating at 40 kV and 20 mA equipped with a Mar-345 image plate detector (MarReasearch, Epp- endorf, ... increase in nonpolar surface area have been suggested as relevant in the adaptation to low temperatures [8,12,14,15,52]. In cit- rate synthases adapted to different temperatur...

Ngày tải lên: 19/02/2014, 16:20