Báo cáo y học: "A novel PTCH1 germline mutation distinguishes basal cell carcinoma from basaloid follicular hamartoma: a case report" pdf

Báo cáo y học: "A novel PTCH1 germline mutation distinguishes basal cell carcinoma from basaloid follicular hamartoma: a case report" pdf

Báo cáo y học: "A novel PTCH1 germline mutation distinguishes basal cell carcinoma from basaloid follicular hamartoma: a case report" pdf

... basaloid follicular hamartoma: a case report Ali Hellani 1 , Hiba Baghdadi 1 , Nidal Dabbour 2 , Nidal Almassri 3 and Khaled K Abu-Amero* 4 Address: 1 PGD laboratory, Saad Specialist Hospital, Al-khobar, ... extended family. Since histology was equivocal and palmoplantar pits are seen in both basaloid follicular hamartoma and nevoid basal cell carcinoma, molecular genet...

Ngày tải lên: 11/08/2014, 19:21

4 369 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Spindle cell oncocytoma of the adenohypophysis in a woman: a case report and review of the literature" pdf

Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Spindle cell oncocytoma of the adenohypophysis in a woman: a case report and review of the literature" pdf

... poster- ior pituitary gland rather than i n the adenohypophysis. These tumours are thought to originate from pituicytes. Granular cell tumors are characterized by a granular cytoplasm which can be observed ... pituicytoma [2]. Case presentation We report the case of a 45-year-old African woman with- out a particular medical history who presented with intermittent decrease of vis...

Ngày tải lên: 11/08/2014, 00:22

4 440 0
Báo cáo y học: "Phenotype changes and impaired function of dendritic cell subsets in patients with sepsis: a prospective observational analysi" ppsx

Báo cáo y học: "Phenotype changes and impaired function of dendritic cell subsets in patients with sepsis: a prospective observational analysi" ppsx

... Sequential Organ Failure Assessment score. Clinical data, microbiological data and 28- day mortality were recorded. Blood samples were collected on the day after enrolment (baseline) and at study day ... HLA-DR expression in each monocyte subset was quantified using a standardized assay as described in Materials and methods, and is given as HLA-DR antibodies per cell (Ab /cell) . (b) For...

Ngày tải lên: 13/08/2014, 18:22

12 237 0
Báo cáo y học: " Long-term survival of chronic dialysis patients following survival from an episode of multiple-organ failure" pdf

Báo cáo y học: " Long-term survival of chronic dialysis patients following survival from an episode of multiple-organ failure" pdf

... of stay for ESRF patients was five days, and they had significantly greater disease severity as measured by APACHE III scores than either those with acute renal failure (ARF) or no renal impairment. ... Ettenger RE, Agodoa LY, Held PJ, Port FK: Comparison of mortality in all patients on dialysis, patients on dialysis awaiting transplantation, and recipients of a first cadaveric transplant....

Ngày tải lên: 13/08/2014, 16:20

7 202 0
Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

... TTAARTGTTTCAACTGTGGCAAAGAAGA MO187 p24 to env OR 6420 - 6445 CAAGCATGKGTAGCCCAGAYATTATG MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT MO191 ... 8241-8220 ACCAATTCCACAYACTTGCCCA MO155 env sequencing 8050-8072 CTGGAACKCTAGTTGGAGTAAT MO042 gag p24 OF-1 890-909 TAGTATGGGCAAGCAGGGAG MO024 gag p24 OF-2 508 - 527 AACCCACTGCTTAA...

Ngày tải lên: 13/08/2014, 01:20

14 334 0
 Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

... pre-hospital emer- gency physicians regard pre-hospital airway management as challenging and recognise that such procedures likely warrant special training beyond the experience of in- hospital airway ... in many countries. However, limited data are available on the actual quality and safety of anaesthesiologist-managed pre-hospital endotracheal intubation (ETI). To explore whether the genera...

Ngày tải lên: 25/10/2012, 09:56

6 612 0
 Báo cáo y học: "Clinical review: Treatment of new-onset atrial fibrillation in medical intensive care patients – a clinical framework"

Báo cáo y học: "Clinical review: Treatment of new-onset atrial fibrillation in medical intensive care patients – a clinical framework"

... U, Tatar H: Supraventricular tachyarrythmia prophylaxis after coronary artery surgery in chronic obstructive pulmonary disease patients (early amiodarone prophylaxis trial). Eur J Cardiothorac Surg ... placebo [91,94-97]. A meta-analysis showed that class IA, class IC and class III antiarrhythmic agents are equally effective in obtaining SR [98]. Meta-analyses comparing amiodarone with clas...

Ngày tải lên: 25/10/2012, 10:35

10 819 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

... Paducah, Paducah, KY, USA 5. Statistician at the Pain Management Center of Paducah, Paducah, KY, USA  Corresponding author: Laxmaiah Manchikanti, MD, 2831 Lone Oak Road, Paducah, Kentucky ... Cash 4 , Vidyasagar Pampati 5 1. Medical Director of the Pain Management Center of Paducah, Paducah, KY and Associate Clinical Professor, Anest- hesiology and Perioperative Medicine, University of...

Ngày tải lên: 26/10/2012, 09:07

12 670 0
Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx

... purified from mouse mastocytoma P-815 was readily phosphorylated by CaM kinase II. Although the TPH from P-815 cells was easily phosphorylated by this kinase, its enzymic activity was not altered by ... that gave the maximum effect on evaluation. TPH was purified from P-815, a mouse mastocytoma, essentially according to Nakata and Fujisawa [8]. Rabbit polyclonal anti-TPH serum was raise...

Ngày tải lên: 08/03/2014, 16:20

9 404 0
Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot

Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot

... medium (MEM) was obtained from Gibco BRL. DFO was obtained from Novartis Pharmaceutical Co. Pyridoxal isonicotinoyl hydrazone (PIH) and its analogue, 2-hydroxy-1-naphthylal- dehyde isonicotinoyl hydrazone ... the pyridoxal isonicotinoyl hydrazone class as effective antiproliferative agents II. The mechanism of action of ligands derived from salicylaldehyde benzoyl hydrazone and 2-hydroxy...

Ngày tải lên: 08/03/2014, 22:20

10 503 0
w