Báo cáo y học: "Two-dimensional power Doppler-three-dimensional ultrasound imaging of a cesarean section dehiscence with utero-peritoneal fistula: a case report" pdf
Báo cáo y học: " laboratory driving simulation for assessment of driving behavior in adults with ADHD: a controlled study" docx
... information from the laboratory at M.I.T with the data at the laboratory at Massachusetts general Hospital. BR: Worked closely with all authors on the design and analysis of the driving data. JFC: ... full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. References 1. Faraone S, Biederman J, Mick...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "vitamin B12 status in patients of Turkish and Dutch descent with depression: a comparative cross-sectional study" pot
... general physical examination was conducted to exclude the possibility of a physical cause of the psychiatric illness. A laboratory examination was also performed that cov- ered electrolytes, hepatic ... and ratio data with a normal distribution were tested with the par- ametric Student t test. Interval and ratio data without a normal distribution and data of an ordinal measu...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α 2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 ... 287 AATAGCTTTACGGGTTTCAGG TIMP-1 TGGGCACCTGCACATCACC 277 CATCTGGGCCCGCAAGGACTG TIMP-2 ATAGTGATCAGGGCCAAAGCAGTC 277 TGTCCCAGGGCACGATGAAGTC TIMP-3 GATGTACCGAGGATTCACCA...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Dietary Use and Conservation Concern of Edible Wetland Plants at Indo-Burma Hotspot: A Case Study from Northeast India" doc
... states of India (namely Arunachal Pradesh, Assam, Meghalaya, Manipur, Mizoram, Naga- land, and Tripura) form an integral part of the Indo- Burma centre of biodiversity hotspot of global signifi- cance ... 8 Nymphaea nouchali Tharo-angangba 2 2 2 2 8 Nymphaea pubescens Tharo-ashangba 2 2 2 2 8 Nymphaea stellata Thariktha 2 2 2 2 8 Nymphoides indica Thariktha-macha 2 2 2 2 8 Oenanthe ja...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Pulmonary stenosis development and reduction of pulmonary arterial hypertension in atrioventricular septal defect: a case report" pdf
... ventricular systolic pressure was 85 mmHg and pulmonary artery (PA) systolic pres- sure almost systemic at 75 mmHg with pulmonary to sys- temic vascular resistance ratio of 0,3, and pulmonary- systemic ... 2006 and 2008. They highlighted a late and progressive development of a valvular and infundibular pulmonary stenosis leading to a normalisation of pulmonary arterial pressures...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Atypical right diaphragmatic hernia (hernia of Morgagni), spigelian hernia and epigastric hernia in a patient with Williams syndrome: a case report" ppsx
... epigastric hernia in a patient with Williams syndrome: a case report Farhan Rashid* 1 , Ramakrishna Chaparala 2 , Javed Ahmed 2 and Syed Y Iftikhar 2 Address: 1 Division of GI Surgery, Clinical ... show any abnormality in a patient with intermittent herniation. CT is the modality of choice for diagnosis of Morgagni's hernia and diagnosis may be established by the p...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: "Marked disability and high use of nonsteroidal antiinflammatory drugs associated with knee osteoarthritis in rural China: a cross-sectional population-based survey" ppt
... the heavy physical demands of farming o r timely availability of knee-replacement sur- gery may be cost-effective measures to reduce this bur- denofpainanddisabilityandpossible NSAIDs-related comorbidity. Abbreviations BMI: ... engaged in heavy occupational physical activity throughout their life span. The aim of this survey was to estimate the burden of disability, analgesia, and hea...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "The association between microvascular and macrovascular endothelial function in patients with rheumatoid arthritis: a cross-sectional study" pdf
... Yeung AC: Close relation of endothelial function in the human coronary and peripheral circulations. J Am Coll Cardiol 1995, 26:1235-1241. 10. Takase B, Hamabe A, Satomura K, Akima T, Uehata A, ... endothelial-independent (glyceryl trinitrate-mediated dilation) macrovascular vasodilatory function. Vasodilatory function was calculated as the percentage increase after each stimulus was appli...
Ngày tải lên: 12/08/2014, 17:21
Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc
... Isola- tion of a new type C retrovirus (HTLV) in primary uncul- tured cells of a patient with Sézary T-cell leukaemia. Nature 1981, 294:268-271. 5. Kalyanaraman VS, Sarngadharan MG, Robert-Guroff ... Miyoshi I, Hatakeyama N, Murakami K, Sawada T, Takimoto Y: Sézary syndrome in an HTLV-I-seronegative, genome-posi- tive Japanese. Am J Hematol 1998, 57:184-185. 28. Ellerbrok H, Fleis...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Filter survival time and requirement of blood products in patients with severe sepsis receiving drotrecogin alfa (activated) and requiring renal replacement therapy" pptx
... received a full course of DrotAA and a minimum of eight days of RRT. Patients' demographic information, markers of disease sever- ity, biochemical and haematological data, details of anticoagu- lation ... alfa (activated) (DrotAA) in addition to the indicated anticoagulation during the DrotAA period. When no additional anticoagulation was administered filters were anticoag...
Ngày tải lên: 13/08/2014, 11:23