Báo cáo y học: " A new modality of treatment for non-united fracture of the humerus in a patient with osteopetrosis: a case report" pptx
Báo cáo y học: "Half-dose verteporfin photodynamic therapy for bullous variant of central serous chorioretinopathy: a case report" doc
... ZHYW had a role in writing a final draft of the manuscript and in the preparation of clinical images. TYYL performed the treatment and follow-up on the patient, and was a major contributor to the ... vitreous c avity showed an absence of any inflammatory reaction suggestive of an inflammatory cause such as Vogt-Koyanagi-Harada dis- ease. A B-scan ultrasound co...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: " Prolonged extracorporeal membrane oxygenation therapy for severe acute respiratory distress syndrome in a child affected by rituximab-resistant autoimmune hemolytic anemia: a case report" pptx
... GF made a substantial contribution in analysing and interpreting the patient s data during the ICU admission and has been involved in drafting the manuscript for the part concerning the ICU admission. ... in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Case report Open Access Prolonged extracorporeal membrane oxygenation therapy f...
Ngày tải lên: 11/08/2014, 17:21
Tài liệu Báo cáo Y học: Interallelic recombination is probably responsible for the occurrence of a new as1-casein variant found in the goat species potx
... GGC AGA GAA TAC GTT TAT ACT AA 3¢ C14L 5¢ TCT CAG ATT GAC TAC TAC AAC TT 3¢ C15U 5¢ CAT GAA AAG CAT TTC AAA AA 3¢ C15L 5¢ TAA AAA ACA GTG GTT ACC AA 3¢ C16U 5¢ CTA AAG AGT ACA CTA TCC TCA C 3¢ C16L ... amplification betweenC7UandC8L.Primersinitalicswereusedinthegenotyping of allele M. C1U 5¢ GAG AGG AAC TGA ACA GAA CAT TG 3¢ C1L 5¢ CAA CTG CGT ATT AGT GAA GAA TG 3¢ C2U 5¢ AAT CAA ATT TTA TTA...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo y học: "Progesterone - new therapy in mild carpal tunnel syndrome? Study design of a randomized clinical trial for local therapy" pptx
... may promote neuroregeneration by sev- eral different actions by reducing inflammation, swelling and apoptosis, thereby increasing the survival of neurons, and by promoting the formation of new ... Neurophysiology Clinic Section, University of Siena, Siena, Italy Full list of author information is available at the end of the article Milani et al. Journal of Brachial Plex...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo Y học: Purification, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx
... bearing covalently bound linear tetrapyrrole (phycobilins) chro- mophores. They are predominantly involved in the photo- synthetic light harvesting process of cyanobacteria and certain algae. With ... of a phycobiliprotein lyase: both the attachment of phy- cocyanobilin and the isomerization to phycoviolobilin are cata- lyzed by the proteins PecE and PecF encoded by the...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
... Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and anti-CD3 antibody. A synergistic effect medi- ated by the VLA-5 fibronectin receptor ... Taufkirchen, Germany) for RNA isolation. RNA was isolated with a mod- ified guanidine thiocyanate/acid phenol method [34] with TriReagent in accordance with the m...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward ... GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAAT...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... used were: for β-actin, for- ward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAG- CAACTCCAGAA. The volume was adjusted ... staining was evident in all nine patients before and during infliximab treatment and was most prominent in the lining layer, in areas with cellular infiltrates and in certain...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... geneti- cally deficient in the IFNAR2 chain of the IFNAR. Autoantibody profiling using autoantigen microarrays in combination with conventional techniques to confirm the array results revealed that, ... USA) on a monthly basis. All animal experiments were approved by, and performed in compliance with, the guidelines of the Institutional Animal Care and Use Committee....
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " An open letter to George M Philip, President of the State University of New York At Al" potx
... rates. Finally, you asserted that the humanities were a drain on the institution financially, as opposed to the sciences, which bring in money in the form of grants and contracts. Let’s examine ... was first isolated and characterized at the National Institutes of Health in the USA and the Institute Pasteur in France, because these were among the few institut...
Ngày tải lên: 09/08/2014, 22:23