Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx
... citation purposes) Journal of Medical Case Reports Open Access Case report Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: ... fibrosis and tubular atrophy. Following rehydration, chemotherapy and free light chain removal using high cut-off haemodialysis, free light cha...
Ngày tải lên: 11/08/2014, 19:21
... resolution of airway inflammation. Transepithelial egression of inflammatory cells at clinical improvement of airways disease Eosinophils In animal models of allergic airway inflammation [11,13,26] airway ... Importantly, with a delay of about two hours also the nasal airway lumen mast cells exhibited a progressive increase in numbers. As with many other aspects of na...
Ngày tải lên: 12/08/2014, 11:22
... analyzed using a two-way analysis of variance (ANOVA); values that were considered significantly different from each other by ANOVA were further analyzed using a post-hoc Tukey's t test. Data having ... lev- els of chemokines and cytokines in the BALF that have been reported to be important in recruiting and activating inflammatory cells to the airways and those that play...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: "Identification of clinical and simple laboratory variables predicting responsible gastrointestinal lesions in patients with iron deficiency anemia"
... identified 1 gastric and 1 colon cancer patient in our study. An early gastric cancer was di- agnosed on biopsy of a suspicious ulcerated area in a 45-year-old man patient. Partial gastrectomy was su ... of ab - dominal pain, abdominal pain with hungry and an - xiety, abdominal distension, nausea, vomiting, poor appetite and symptoms of gastroesophageal reflux. All pati...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: " Preparation of RGD-modified Long Circulating Liposome Loading Matrine, and its in vitro Anti-cancer Effects"
... evaluation of liposomal chloroquine diphosphate loaded by a transmem- brane pH-gradient method. Int J Pharm. 2008; 361:56-63. 22. Maitani Y, Aso Y, Yamada A, et al. Effect of sugars on storage ... (Sigma-Aldrich) was added to each well. Finally, the absorbance of each well was meas- ured at 570 nm. All MTT assays were repeated two times. The relative growth rate was calculate...
Ngày tải lên: 26/10/2012, 08:57
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... complex of lactoferrin with a lanthanide ion (Sm 3+ )at3. 4A ˚ resolution. Acta Crystallogr. D55, 1799–1804. 36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti- tative image analysis ... solution was prepared by mixing YbCl 3 and apo-Tf solutions in a molar ratio of 2.5 : 1 and the free Yb was removed by ultrafiltration. As indicated in the Results sect...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx
... that cyclosporin A (CsA), vinblastine, and valinomycin (and several other drugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo ´ Jr, unpublished data) 1 interactwithPgpinsuchamannerthat preincubation ... at 37 °C in an incubator containing 5% CO 2 and maintained by regular passage in Dulbecco’s minimal essential medium (supplemented with 10% heat- inactivated fetal bovine serum, 2 m...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Secretion of egg envelope protein ZPC after C-terminal proteolytic processing in quail granulosa cells doc
... Antibodies: A laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 37. Kohsaka, T., Takahara, H., Sasada, H., Kawarasaki, T., Bamba, K., Masaki, J. & Tagami, S. ... transported selectively from the Golgi apparatus toward the apical surface of granulosa cells, which are apposed to the PL. In polarized Madin–Darby canine kidney cells, the O-glyco- syla...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "Effect of increasing intraperitoneal infusion rates on bupropion hydrochloride-induced seizures in mice" pptx
... study, the animals were maintained in a facility fully accredited by the Standards Council of Can- ada (SCC) and the care and use of the animals was con- ducted in accordance with the guidelines ... in the hazard (probability) of a mouse having a convulsion when the infusion rate increases by 1 min. This hazard ratio is consistent with the odds ratio obtained by lo...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reacti" potx
... Probe ADAMTS5 TGGGTTCCCAAATATGCAG CTGTCCCATCCGTCACCT CTGGGAGA 1AGC1 GGGACCTGTGTGAGATCGAC GTAACAGTGGCCCTGGAACT AGGAGCTG BGN CAGAACAACGACATCTCAGAGC TCACCAGGACGAGAGCGTA CTCCACCA COL 1A2 CTATCAATGGTGGTACCCAGTTT ... ACTCTGGGATCACGCATGT CTGCCTTC LUM ACCTGGAAATTCTTTTAATGTATCATC CGGTATGTTTTTAAGCTTATTGTAGGA TGCTGGAG MMP13 CCGCGACCTTATCTTCATCT AACCTTCCAGAATGTCATAACCA AGAGGCAG RPL1 3A CTGCCCCACAAGACCAA...
Ngày tải lên: 09/08/2014, 08:22