Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps

... chromosome 1p in a 9-year-old girl with a monosomy 1p3 6 related phenotype and a family history of learning difficulties: a case report Gregory J Fitzgibbon* 1 , Jill Clayton-Smith 2 , Siddharth Banka 2 , ... result of a de-novo rearrangement or as a consequence of malsegregation of a balanced parental translocation at meiosis. Case prese...

Ngày tải lên: 11/08/2014, 19:21

... hyp- oechogenic area adjacent to the head of the pancreas. It was initially diagnosed as a cystic lesion of the pancreas. Laboratory examinations showed an increase in the levels of amylase (306 U/liter, ... pancreatitis due to a combination of PD and duo- denal diverticulum. Case presentation A 75-year-old man with a clinical history of recurrent pan- creatitis (m...

Ngày tải lên: 11/08/2014, 23:21

... function among phenotypically distinct strains. Materials and methods Bacterial strains, growth conditions, and preparation of genomic DNA C. trachomatis strains (A/ Har1, B/TW-5, Ba/Apache-2, ... Visconti for assistance in printing the microarray slides and Jeanne Moncada for help in the propagation of several of the chlamydial strains. We also thank George F. Sensabaugh fo...

Ngày tải lên: 09/08/2014, 20:20

... the plant family Brassicaceae, while a third has made a host jump across plant families and is a parasite of members of the family Resedaceae. The sequences of metagenomes - the total DNA of ... and several independent lineages of unicellular microorganisms. Communications from Nicole King (University of California, Berkeley, USA), Franz Lang (University of Mon...

Ngày tải lên: 09/08/2014, 20:21

... related to sugar metabolic processes. E1 and E2 – single data type analysis using expression data; C1 and C2 – single data type analysis using copy number data. marginally outperforms the integrative ... by integrative and meta-analytic approaches but not by any of the single-data-type analyses (see Methods for details). The Meta-analytic approaches show minimal improvement over...

Ngày tải lên: 09/08/2014, 23:20

... are fast and cheap, and capable of fingerprinting the species with sequence information available in the existing databases. In contrast, sequence-independent arrays are laborious and costly but ... [4]. Development and acceptance of herbal medicine are hindered by misidentification and adultera tion of medic- inal herbs which may lead to loss of therapeutic pot ency...

Ngày tải lên: 13/08/2014, 14:20

... Stratagene's ArrayAssist ® . Many of them are extensions of previously known software products for standard arrays, and their major analytical aims overlap with those available in exonmap and BioConductor/ R, ... genome annotation and probeset location data that led to the development of a single inte- grated database rather than building a database containing only pr...

Ngày tải lên: 14/08/2014, 07:21

... a significant change in the expression of a specific gene, in a panel of phenotypically characterized rat recombinant inbred strains. This systematic approach resulted in the mapping of many novel ... Genomics and Models’ meeting in 2003, several labs have produced a total of 15 targeted ethylnitrosourea (ENU)-induced knockout models and over 60 mutants with amin...

Ngày tải lên: 14/08/2014, 16:21

... calculations; measures of disease; parametric and non-parametric tests; simple regression; and analysis of survival data. Ideally the series will evolve to meet the needs of Critical Care readers, and you are encouraged ... widespread use, it is important that all those involved in research or the management of patients have a sound grasp of at least the basics of statis...

Ngày tải lên: 25/10/2012, 10:45

... 5'- CTTCAAGCTGAGCGACATTGG -3' (forward) and 5'- AGCATGAGAAATTGGCTCCGT -3' (reverse) for ICAM-1 and 5'- ACCACAGTCCATGCCATCAC -3' (forward) and 5'- TCCACCACCCTGTTGCTGTA ... electrophoresed in a 1.5% agarose gel and stained with ethidium bromide. The intensity of each ICAM-1 mRNA band was quantified by densi- tometry using a gel documenta...

Ngày tải lên: 25/10/2012, 11:00