0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx

Báo cáo y học:

Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx

... Case ReportsOpen Access Case reportFast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case reportJens Waldmann*1, Nils Habbe1, Volker ... programs in patients with multiple endocrine neoplasia type 1 are intended to detect and treat malignant tumors at theearliest stage possible. Malignant neuroendocrine pancreatic tumors are the ... postoperatively in the case of a newly diagnosed lesion, taking into consider-Histological characteristics of the neuroendocrine tumor at initial operation and the neuroendocrine carcinoma of the pan-creas...
  • 7
  • 238
  • 0
báo cáo khoa học:

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

... this article as: Griniatsos et al.: Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novelmutation in the MEN1 gene. World Journal of Surgical ... 2005,89:143-150.11. Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E,Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 genecausing familial isolated primary hyperparathyroidism. ... IA, Skarulis M, Li G, Moon YW, Park WS, Weil R,Barlow C, Spiegel AM, Marx SJ, Zhuang Z: Multiple endocrine neoplasia type 1: atypical presentation, clinical course, and genetic analysis ofmultiple...
  • 7
  • 412
  • 0
Báo cáo Y học: Double-stranded RNA-activated protein kinase interacts with apoptosis signal-regulating kinase 1 Implications for apoptosis signaling pathways docx

Báo cáo Y học: Double-stranded RNA-activated protein kinase interacts with apoptosis signal-regulating kinase 1 Implications for apoptosis signaling pathways docx

... Japan;2Graduate school of Medical Science, Kanazawa University, Kanazawa, Ishikawa, JapanDouble-stranded RNA-activated protein kinase (PKR), a serine/threonine kinase, is activated in virus-infected ... precise pathway linking PKR and the MAPKfamily remains to be elucidated.Apoptosis signal-regulating kinase 1 (ASK1) is a MAPKkinase kinase (MAPKKK) that acts upstream of JNK andp38 MAPKs [14,15]. ... conjugated with fluorescein isothiocya-nate (FITC) (MBL, Nagoya, Japan) or anti-(rabbit IgG)conjugated with tetaramethyl rhodamine isothiocyanate(RITC) (Jackson Immunoresearch Laboratory, WestGrove,...
  • 7
  • 361
  • 0
Báo cáo y học:

Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

... sedation, but no data on psy-chotic symptoms are analysed. Additionally, there is a concern regarding aripiprazole and olanzapine mainte-nance data because the relevant studies included patientswho ... percentage).Trial Target Overall side effects Anxiety Agitation Acathisia Constipation Headache Hyperprolactinaemia Insomnia Nausea SedationCN138-009 Mania 8 1 9 7 5 -6 6 13 15CN138-074 Mania 6 ... and bipolarII disorders: dose-response relationship with bipolar familyhistory. Psychopathology 2008, 41(1):39-42.10. Selva G, Salazar J, Balanza-Martinez V, Martinez-Aran A, Rubio C,Daban...
  • 10
  • 548
  • 0
Báo cáo y học:

Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx

... T, Karampelas Ioannis, Karydas Georgios, Karabinis Andreas:Unilateral and bilateral vertebral artery dissection followingmotor vehicle injury – two cases and a mini-review. Interna-tional Journal ... purposes)Journal of Brachial Plexus and Peripheral Nerve InjuryOpen Access Case reportTraumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracturesSilas ... Dill-Macky Marcus J, Khangure Mark, Song Swithin: Traumatic cer-vical distraction complicated by delayed reduction due totraumatic vertebral artery pseudo-aneurysm. AustralasianRadiology 1999,...
  • 4
  • 371
  • 0
Báo cáo y học:

Báo cáo y học: "Ketamine as an adjuvant in sympathetic blocks for management of central sensitization following peripheral nerve injury" pptx

... treatment of a nine -year old case of Complex Regional Pain syndrome Type I [ReflexSympathetic Dystrophy] with intravenous Ketamine – Infu-sion therapy in a warfarin anticoagulated adult female patient. ... thalamocortical dissociation affected by Ket-amine may have a role to play in its therapeutic action. Allthe patients in this case series had heat allodynia andresponded to sympatholysis with Ketamine. ... Neuropathic pain scale score [16]. Ourpatients exhibited SMP along with heat and mechanicalallodynia.Ketamine has been administered orally, as an ointment,intravenously, subcutaneously, epidurally...
  • 6
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: "Near full-length genome analysis of low prevalent human immunodeficiency virus type 1 subclade F1 in São Paulo, Brazil" docx

... Santos AF, Sousa TM, Soares EA, Sanabani S, Martinez AM, Sprinz E,Silveira J, Sabino EC, Tanuri A, Soares MA: Characterization of a new circulating recombinant form comprising HIV-1 sub-types ... F1 sequences obtained in this study dis-played open and intact reading frames for majority of HIVproteins. To exclude laboratory strains contamination, a BLAST search of GenBank HIV-1 sequences ... found a close phylogenetic relationship between Angolan andRomanian HIV-1 subtype F1 isolates and thus lent furthersupport to available published data that indicated an Afri-can origin of subtype...
  • 11
  • 280
  • 0
Báo cáo y học:

Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt

... bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301 bp(-92~+141)Quantitative MSP primersDAPK-qFDAPK-qRAG(C/T)G(C/T)GGAGTTGGGAGGAGTACAAAC (A/ G)ACCAATAAAAACCCTACAAAC121 ... PrimerRASSF 1A- TFRASSF 1A- TRCGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTTGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCCCAAAATCCAAACTAAAC337 bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 ... bp(-254~+39)DAPK-TFDAPK-TRCGACTCCTGCACTCATTAACCCTCACTAAAGTGGGTGTGGGG(T/C)GAGTGGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTCC (A/ G)C (A/ G)AAAAAAACAAAATC358 bp(-240~+50)PAX5β-TFPAX5β-TRCGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTGGGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC301...
  • 12
  • 383
  • 0
Báo cáo y học:

Báo cáo y học: " Surfactant disaturated-phosphatidylcholine kinetics in acute respiratory distress syndrome by stable isotopes and a two compartment model" potx

... technique includes bothintracellular surfactant and non-surfactant membranesthat, with time, incorporate a fraction of administereddisaturated-phosphatidylcholine.Surfactant in ARDS In patients with ... Italy, 3Department of Pharmacology, Anaesthesia and Critical Care, University of Padova, Padova, Italy, 4Respiratory Unit, General Medical Hospital, Padova, Italy, 5Department of Medical ... that the sys-tem was at steady state, thus allowing the use of a lineartime invariant compartmental model to describe disatu-rated-phosphatidylcholine kinetics.Data were analysed according...
  • 12
  • 224
  • 0
Báo cáo y học:

Báo cáo y học: " Peripheral blood B lymphocytes derived from patients with idiopathic pulmonary arterial hypertension express a different RNA pattern compared with healthy controls: a cross sectional study" pdf

... screening. Leuk Lymphoma2007, 48(5):978-986.27. Hatanaka H, Takada S, Choi YL, Fujiwara S, Soda M, Enomoto M,Kurashina K, Watanabe H, Yamashita Y, Sugano K, Mano H: Trans-forming activity of ... his laboratory for their most valuable technical assistance with B cell purification and char-acterization and to Ted Shade in the microarray core facility for assistance with data analysis.References1. ... RNAmicroarray was performed.Microarray data generationRNA quality assessment, sample preparation, reverse tran-scription, labeling, high-density oligonucleotide arrayhybridization, scanning...
  • 7
  • 296
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ