Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx
Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx
... Case Reports Open Access Case report Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report Jens Waldmann* 1 , Nils Habbe 1 , Volker ... programs in patients with multiple endocrine neoplasia type 1 are intended to detect and treat malignant tumors at the earliest stage possible. Maligna...
Ngày tải lên: 11/08/2014, 19:21
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... this article as: Griniatsos et al.: Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene. World Journal of Surgical ... 2005, 89:143-150. 11. Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing fami...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo Y học: Double-stranded RNA-activated protein kinase interacts with apoptosis signal-regulating kinase 1 Implications for apoptosis signaling pathways docx
... Japan; 2 Graduate school of Medical Science, Kanazawa University, Kanazawa, Ishikawa, Japan Double-stranded RNA-activated protein kinase (PKR), a serine/threonine kinase, is activated in virus-infected ... precise pathway linking PKR and the MAPK family remains to be elucidated. Apoptosis signal-regulating kinase 1 (ASK1) is a MAPK kinase kinase (MAPKKK) that acts upstream of JNK and p3...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps
... sedation, but no data on psy- chotic symptoms are analysed. Additionally, there is a concern regarding aripiprazole and olanzapine mainte- nance data because the relevant studies included patients who ... percentage). Trial Target Overall side effects Anxiety Agitation Acathisia Constipation Headache Hyperprolactinaemia Insomnia Nausea Sedation CN138-009 Mania 8 1 9 7 5 -6 6 13 15 CN138-074...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical spinal fracture" pptx
... T, Karampelas Ioannis, Karydas Georgios, Karabinis Andreas: Unilateral and bilateral vertebral artery dissection following motor vehicle injury – two cases and a mini-review. Interna- tional Journal ... purposes) Journal of Brachial Plexus and Peripheral Nerve Injury Open Access Case report Traumatic vertebral artery dissection in an adult with brachial plexus injury and cervical sp...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Ketamine as an adjuvant in sympathetic blocks for management of central sensitization following peripheral nerve injury" pptx
... treatment of a nine -year old case of Complex Regional Pain syndrome Type I [Reflex Sympathetic Dystrophy] with intravenous Ketamine – Infu- sion therapy in a warfarin anticoagulated adult female patient. ... thalamocortical dissociation affected by Ket- amine may have a role to play in its therapeutic action. All the patients in this case series had heat allodynia and re...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Near full-length genome analysis of low prevalent human immunodeficiency virus type 1 subclade F1 in São Paulo, Brazil" docx
... Santos AF, Sousa TM, Soares EA, Sanabani S, Martinez AM, Sprinz E, Silveira J, Sabino EC, Tanuri A, Soares MA: Characterization of a new circulating recombinant form comprising HIV-1 sub- types ... F1 sequences obtained in this study dis- played open and intact reading frames for majority of HIV proteins. To exclude laboratory strains contamination, a BLAST search of GenBank HIV-1 sequ...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Gene promoter methylation assayed in exhaled breath, with differences in smokers and lung cancer patients" ppt
... bp (-240~+50) PAX5β-TF PAX5β-TR CGACTCCTGCACTCATTAACCCTCACTAAAGGTTATTTTGATTGGTTTGGTG GGCCAGTGAATTGTAATACGACTCACTATAG GGAGGCGGCTACC (A/ G)AAACTAAAATAAAAC 301 bp (-92~+141) Quantitative MSP primers DAPK-qF DAPK-qR AG(C/T)G(C/T)GGAGTTGGGAGGAGTA CAAAC (A/ G)ACCAATAAAAACCCTACAAAC 121 ... Primer RASSF 1A- TF RASSF 1A- TR CGACTCCTGCACTCATTAACCCTCACTAAAGAGGGT(T/C)GGATGTGGGGATTT GGCCAGTGAATTGTAATACGAC...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Surfactant disaturated-phosphatidylcholine kinetics in acute respiratory distress syndrome by stable isotopes and a two compartment model" potx
... technique includes both intracellular surfactant and non-surfactant membranes that, with time, incorporate a fraction of administered disaturated-phosphatidylcholine. Surfactant in ARDS In patients with ... Italy, 3 Department of Pharmacology, Anaesthesia and Critical Care, University of Padova, Padova, Italy, 4 Respiratory Unit, General Medical Hospital, Padova, Italy, 5 Depart...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: " Peripheral blood B lymphocytes derived from patients with idiopathic pulmonary arterial hypertension express a different RNA pattern compared with healthy controls: a cross sectional study" pdf
... screening. Leuk Lymphoma 2007, 48(5):978-986. 27. Hatanaka H, Takada S, Choi YL, Fujiwara S, Soda M, Enomoto M, Kurashina K, Watanabe H, Yamashita Y, Sugano K, Mano H: Trans- forming activity of ... his laboratory for their most valuable technical assistance with B cell purification and char- acterization and to Ted Shade in the microarray core facility for assistance with data analy...
Ngày tải lên: 12/08/2014, 15:21