báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps
... purposes) Harm Reduction Journal Open Access Case report The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange ... Licentiate to Heal: A History of the Medical Council of Canada Ottawa: Medical Council of Canada; 2007. 2. Kerr RB: History of the...
Ngày tải lên: 11/08/2014, 18:21
... with a video camera coupled to an image analyser (ΔT area meter; ΔT devic- es, Cambridge, UK). Mineral analyses The total nitrogen content of the dried and ground ... weight (ratio of needle dry weight to needle area). Gas exchange and water-use efficiency Table II gives the mean values of CO 2 as- similation rate (A)...
Ngày tải lên: 09/08/2014, 03:25
... shoots according to the architectural scenario) was assumed to be random; the leaf area density (LAD, half the total needle area per unit crown volume) was assumed to be ... shoots was used to correct the LAI estimates in the (S) scenarios. Finally, the actual data and the PCA estimates of the ver- tical LAI profiles were compared...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... and are not related to the presence of abnormalities on the CXR. Unfortunately, these abnormalities formed a sub- stantial part of all new and unexpected abnormalities in our analysis (1.0% and ... analysis of the study. MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revi- sion. All authors read and approved the final...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... tandemly repeated domains in BPPs. We conjecture that dual-domain BPPs have succeeded evolutionarily because they can increase the amount of available phosphate by interacting together. Additionally, fusing ... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released fro...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This ... artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinase assay visualized...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... NF-Y appears to form interactions also with other activating factors. The results of employing plasmid-based ChIP assays on the Cdc2 promoter indicate that E2F3 binding to the distal acti- vating ... promoter as analyzed by chromatin immunoprecipitations and can activate tran- scription of the promoter in transient transfection assays through the upstream part of the SIRF elem...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... of apoptosis through the mitochondrial pathway. The key event in the mito- chondrial pathway is the release of proapoptotic fac- tors from the mitochondrial intermembrane space into the cytosol, ... release of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc
... with WB anti-flag WB anti-HA TIAR-flag BOIP-flag HA-hnRNP M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnRNP ... W13 4A HA-ASF FF-DD W13 4A HA-ASF/SF2 WT HA-ASF/SF2 WT HA-ASF/SF2 FF-DD HA-ASF/SF2 FF-DD HA-ASF/SF2 W13 4A HA-ASF/SF2 W13 4A HA-ASF/SF2 RD HA-ASF/SF2 RD HA-ASF ΔRS1 HA-ASF ΔRS2 HA-ASF FF-...
Ngày tải lên: 16/02/2014, 15:20