... Central Page 1 of 8 (page number not for citation purposes) Harm Reduction Journal Open Access Case study Bundling occupational safety with harm reduction information as a feasible method for improving ... programs, and regu- lar meetings are held between police and harm reduction actors [44]. Harm reduction training for police has also been con...
Ngày tải lên: 11/08/2014, 18:20
... iliac crest and Grafton ® -DBM-Putty (Osteotech, Eatontown, NJ, USA) was used for the maxil- lary sinus floor augmentation. The lateral augmentation was performed using screw fixed autogenous ... final res- tauration was placed (figure 5). Discussion The main basic criteria for restauration of the edentulous maxilla and mandible are adequate bone mass and ortholalveolar form [6]. This can...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf
... Trypan Blue staining was carried out as described [35]. FACS analysis was performed as described previ- ously [36]. A FACScan flow cytometer system (Becton Dickinson, Europe) was used to count ... provided. An endoscopy examination was carried out to obtain tissue for diagnosis, during which gastric juice was aspirated from the gastric fundic region using a suction trap, and th...
Ngày tải lên: 23/03/2014, 10:21
báo cáo khoa học: " Giant sigmoid diverticulum with coexisting metastatic rectal carcinoma: a case report" ppt
... The last type of GDC occurs as a result of a previous colonic perforation, mostly due to diverticu- lar disease. A ball-valve mechanism has been suggested by Nano et al. as a ca use of a gradual ... hysterectomy and right sal- pingo-opherectomy was performed (Figure 4) and a colostomy was fashioned. It was not possible to perform colorectal anastomosis due to the conside...
Ngày tải lên: 11/08/2014, 02:21
báo cáo khoa học: " Coffin-Siris syndrome with Mayer-RokitanskyKüster-Hauser syndrome: a case report" pptx
... case of an unusual association of Coffin-Siris syndrome with Mayer-Rokitansky-Küster- Hauser syndrome. This association has never previously been reported in the medical literature. Case presentation: ... year and walking at around three years of age. Her speech was also delayed, and at nine years, she c ould understand only simple commands and speak few words. She was a child of a no...
Ngày tải lên: 11/08/2014, 02:22
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... binding to nucleic acids, was expressed in Escherichia coli as proteins fused to glutathione S- transferase (GST) and purified using glutathione agarose. 32 P-labeled ETS-1 was first incubated for 24 ... Kurokawa 3 and Takanori Oyoshi 1 1 Department of Chemistry, Faculty of Science, Shizuoka University, Japan 2 Kagawa School of Pharmaceutical Sciences, Tokushima Bunri University, Kagaw...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... analyzer such as KNP (Kurohashi and Na- gao, 1994) or CaboCha (Kudo and Matsumoto, 2002). Although this information is less accu- rate than manually annotated information, these automatic analyzers ... judg- ing which bunsetsu a bunsetsu modifies, this type of work has used as features the information of two bunsetsus, such as the head words of the two bunsetsus, and the morphemes...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 C UAGACUAGA 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 ... 46, 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al. 87...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
... ATP as a sub- strate instead of the lysine-aspartate consensus. We show that the purified catalytic domain of Rv0386 is active as an AC which has an unusually high GC side- activity. Mutational ... catalysis. Furthermore the asparagine-aspartate couple which replaces the usual substrate-specifying lysine-aspartate pair does not bind to the purine moiety and is dispen- sable for catal...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... that laugh wrinkles is an instance of CAUSE-EFFECT. While there are not many success stories so far, measuring seman- tic similarity has proven its advantages for textual entailment (Tatu and ... 28(3):317– 332. Yusuke Shinyama, Satoshi Sekine, and Kiyoshi Sudo. 2002. Automatic paraphrase acquisition from news ar- ticles. In Proceedings of HLT, pages 313–318. Marta Tatu and Dan Moldovan....
Ngày tải lên: 08/03/2014, 01:20