báo cáo khoa học: " NAOMI: The trials and tribulations of implementing a heroin assisted treatment study in North America" ppsx

... why there is/was a need for a heroin assisted treatment trial; a description of heroin assisted treatment; the beginnings of creating the NAOMI study in North America; what is the NAOMI study; the ... 14 (page number not for citation purposes) Harm Reduction Journal Open Access Case study NAOMI: The trials and tribulations of implementing a...

Ngày tải lên: 11/08/2014, 18:20

... estimate the parameter values of the evaluated tagger in order to constrain as much as possible the intervals; the statistical significance of the interval overlappings; a more informed (and less ... training and test sets are extracted from the same corpus, they will prob- ably contain the same kind of errors in the same kind of situations. This may cau...

Ngày tải lên: 08/03/2014, 05:21

... taking place in Calgary and Halifax. The phased approach has several advantages. For instance, it allows us to train the research assistants from the Calgary and Hali- fax areas in a central location. ... in this area, and the investigators have established partnerships with the associated national professional associations who will facilitate the current project an...

Ngày tải lên: 11/08/2014, 05:22

...

Ngày tải lên: 07/08/2014, 18:21

... resuscitation and blood transfusion in order to maintain hemodynamic stability. Secondly, the size of the tumor and the fact that the upper endoscopy showed a continuous and profuse intraluminal bleeding, which ... whenever there is a presentation of sudden abdominal pain in patients with an intraabdominal mass. Emergency local excision with negative margins associ-...

Ngày tải lên: 09/08/2014, 07:21

... of the lineages and sublineages Classification and designation of the lineages and sublin- eages within type A influenza virus are essential for the studies of the viral evolution, ecology and ... have been classified into some lineages and sublineages, such as the North American lin- eage, the gull lineage, the human-like swine lineage, etc [4-9]. In the...

Ngày tải lên: 12/08/2014, 04:20

... (Bras- sica napus and Brassica rapa) and vegetables such ase cabbage (Brassica oleraceae var. capitata), cauliflower (B. oleraceae var. botrytis) and broccoli (B. oleraceae Keywords brassinin; cyclobrassinin; ... phytoalexins brassicanal A, erucalexin, rutalexin, brassilexin, cyclobrassinin and camalexin (0.10 and 0.30 mm final concentrations). The phyto- alexin that displayed an i...

Ngày tải lên: 18/02/2014, 14:20

... widespread in the Archaea and Bacteria domains [11]. Among the broad range of physiological processes in which they participate, CA can play a significant role in autotrophic organisms, serving as an ... around the nucleus and is maxi- mal in the cytoplasmic apex of the branchial epidermis. By contrast, the staining is very weak basally along the myoepithelium t...

Ngày tải lên: 18/02/2014, 16:20

... tÞð2Þ A and k a are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and k b are the same parameters for the slow fraction; t is reaction time (min). These parameters ... bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase...

Ngày tải lên: 19/02/2014, 07:20