báo cáo khoa học: " NAOMI: The trials and tribulations of implementing a heroin assisted treatment study in North America" ppsx

... why there is/was a need for a heroin assisted treatment trial; a description of heroin assisted treatment; the beginnings of creating the NAOMI study in North America; what is the NAOMI study; the ... 14(page number not for citation purposes)Harm Reduction JournalOpen AccessCase study NAOMI: The trials and tribulations of implementing a heroin assisted treatment study in North AmericaCandice ... the case study. NL was also involved with the study in the early days and added intellectual content for the case study. MTS is the principal investigator of the study, wasinvolved in revising...

Báo cáo khoa học: "On the Evaluation and Comparison of Taggers: the Effect of Noise in Testing Corpora." doc

... estimate the parameter values of the evaluated tagger in order to constrain as much as possible the intervals; the statistical significance of the interval overlappings; a more informed (and less ... training and test sets are extracted from the same corpus, they will prob- ably contain the same kind of errors in the same kind of situations. This may cause the training procedure to learn the ... Disambiguating Word Senses: An Illustration of the Role of Bias in Machine Learning. In Proceed- ings of EMNLP'96 conference. Samuelsson, C. and Voutilainen, A. 1997. Compar- ing a Linguistic...

báo cáo khoa học: " Defining the effect and mediators of two knowledge translation strategies designed to alter knowledge, intent and clinical utilization of rehabilitation outcome measures: a study protocol [NCT00298727]" docx

... taking place in Calgary and Halifax. The phasedapproach has several advantages. For instance, it allows usto train the research assistants from the Calgary and Hali-fax areas in a central location. ... in this area, and the investigators have establishedpartnerships with the associated national professionalassociations who will facilitate the current project and arising national KT initiatives. The ... understanding of the interpretation of responses during the chart-stimulatedrecall. Their orientation will consist of training on the the-ory and methods of chart-stimulated recall, participationin...

Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

... ...

Báo cáo khoa học: "Spontaneous intratumoral bleeding and rupture of giant gastric stromal tumor ( 30 cm) in a young patient" pot

... resuscitation and blood transfusion in order to maintain hemodynamic stability. Secondly, the size of the tumor and the fact that the upper endoscopyshowed a continuous and profuse intraluminal bleeding,which ... whenever there is a presentation of suddenabdominal pain in patients with an intraabdominal mass.Emergency local excision with negative margins associ-ated with adjuvant therapy with KIT tyrosine ... Emergency localexcision with negative margins associated with adjuvant therapy with imatinib mesylate remains the main modality of treatment for high risk GISTs.BackgroundGastrointestinal stromal tumor...

Báo cáo khoa học: " Panorama phylogenetic diversity and distribution of type A influenza viruses based on their six internal gene sequences" pdf

... of the lineages and sublineagesClassification and designation of the lineages and sublin-eages within type A influenza virus are essential for the studies of the viral evolution, ecology and ... have been classified into somelineages and sublineages, such as the North American lin-eage, the gull lineage, the human-like swine lineage, etc[4-9]. In the past century, type A influenza ... manuscript.Additional materialAdditional file 1 The designations and alignment of the representative sequences of PB2 gene. The data could be read out with NotePad and the Mega soft-ware, and gaps are...

Tài liệu Báo cáo khoa học: Substrate speciﬁcity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

... (Bras-sica napus and Brassica rapa) and vegetables such asecabbage (Brassica oleraceae var. capitata), cauliﬂower(B. oleraceae var. botrytis) and broccoli (B. oleraceaeKeywordsbrassinin; cyclobrassinin; ... phytoalexins brassicanal A, erucalexin,rutalexin, brassilexin, cyclobrassinin and camalexin(0.10 and 0.30 mm ﬁnal concentrations). The phyto-alexin that displayed an inhibitory effect was furtherexamined ... L. maculans and A. brassicicola catalyse the detoxiﬁcation of brassinin by hydrolysis of its dithiocarbamate groupto indolyl-3-methanamine. The puriﬁcation and characterization of brassi-nin...

Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... widespread in the Archaea and Bacteria domains[11]. Among the broad range of physiological processes in which they participate, CA can play a signiﬁcantrole in autotrophic organisms, serving as an ... around the nucleus and is maxi-mal in the cytoplasmic apex of the branchial epidermis.By contrast, the staining is very weak basally along the myoepithelium that lines the internal coelomic cavity.Although ... example in algal–cnidariansymbioses [13]. In the same way, measurements of CAactivity in several chemosynthetic clam and vestimen-tiferan species indicate that CA facilitates inorganiccarbon...

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... tÞð2Þ A and k a are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kbare the sameparameters for the slow fraction; t is reaction time (min).These parameters ... bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (45 nucleotides, TAATACGACTCACTATAGGGATCGAATTCTGGGTTCAAAACGTAA)contains, in order, a T7 RNA polymerase promoter (nucleo-tides 1–17), a ... in the L9.1 and P7.1 loops may form a novel base-pairing interaction; the gray dashed line between L2 and P8 also indicates a possible interaction. Solid arrows indicate sites of Mn2+cleavage...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ