báo cáo khoa học: " Antibiotic resistance as a global threat: Evidence from China, Kuwait and the United States" pdf

... citation purposes) Globalization and Health Open Access Research Antibiotic resistance as a global threat: Evidence from China, Kuwait and the United States Ruifang Zhang 1 , Karen Eggleston* 2 , ... correlated; the most correlated were China and Kuwait, followed by Kuwait and the U.S., and the least correlated pair was China and the U.S. Conclus...

Ngày tải lên: 11/08/2014, 18:20

... sol- ids – oral preparation stage) and oral final stages [5]. In case of liquid swallowing, during the oral initial stage the water intake takes place and a labial seal occurs. The oral final stage occurs ... during the eval- uation of the recordings. By the same reason, the data taken from the OO electrode location is the least inform- ative and safely can be omit...

Ngày tải lên: 11/08/2014, 20:20

... cardiac function in the cardiac variant of Fabry’s disease with galactose-infusion therapy. N Engl J Med 345, 25–32. 18 Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan ... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fan J-Q &...

Ngày tải lên: 18/02/2014, 16:20

... antibody libraries [15]. Here, the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies ... for target can be measured by standard methods (immunoassay or surface plasmon resonance) at the temperature of the phage selection (or at temperatures at which the var...

Ngày tải lên: 19/02/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) an...

Ngày tải lên: 19/02/2014, 17:20

... planning specification language and show how LTAG grammaticality can be encoded as a PDDL problem and how we can reconstruct an LTAG derivation from the plan. 2.1 Tree-adjoining grammars The grammar ... the atoms subst(S, 1.self) and step(1) and a final state consisting of the following goal: A, u.¬subst (A, u) ∧ A, u.¬mustadjoin (A, u). We can then send the actions...

Ngày tải lên: 20/02/2014, 12:20

... greatest interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes. The rule i s constructed with training ... algorithm. The data were analysed with a window of five wavenumbers, assuming that adjacent wavenumbers are highly corr elated. A population o f 3 2 solutions was built at each...

Ngày tải lên: 21/02/2014, 03:20

... base in the 5¢…CCT/AGG…3¢ sequence. Materials and methods Chemicals and enzymes AdoMet and AdoHcy were from Sigma (USA). [CH 3 – 3 H]AdoMet (77 CiÆmmol )1 ) was from Amersham (USA). [ 32 P]ATP[cP] ... curves. Thermodynamic parameters and their standard deviations were determined from fitting the theoretical melting curves to experimental curves (see Materials and methods)....

Ngày tải lên: 07/03/2014, 15:20

... h; Asp255His, 4.5 h; Pro136Leu, 8 h). After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum. Precipi- tated ASA was quantified after SDS ⁄ PAGE with a ... proteinases. Proc Natl Acad Sci USA 80, 6066–6070. 13 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fab...

Ngày tải lên: 07/03/2014, 17:20

... grammar and the role of the grammar in the global nature of the control must be given. 3.2 The Local Representation of the Grammar The grammar space contains the locally de- fined grammar ... for a grammar. The neurolinguistic literature demonstrates that the grammar can be affected in isolation from other aspects of language function. (Cf Studies of agramm...

Ngày tải lên: 08/03/2014, 18:20