báo cáo khoa học: " Yulu Shequ - a unique rehabilitation program for illicit drug users in Kaiyuan in southwest China" potx

... CAS E STU D Y Open Access Yulu Shequ - a unique rehabilitation program for illicit drug users in Kaiyuan in southwest China Qinqin Liu 1 and Christian A Gericke 2* Abstract Introduction: In ... Recently, a new model of drug user rehabilitation called the Yulu Shequ Program has gained a national reputation for successful rehabilitation in t...

Ngày tải lên: 11/08/2014, 18:20

... orientation of vitamin B 12 on binding and number of combining sites of human intrin- sic factor and the transcobalamins. Biochim Biophys Acta 243, 75–82. 12 Marchaj A, Jacobsen DW, Savon SR & ... CNCbl was performed with help of 1,1¢-dicarbo- nyl-di-(1,2,4-triazole) as described elsewhere [19,20], where- upon 4,7,10-trioxa-1,13-tridecanediamine was conjugated as a spacer [19,20]. Amin...

Ngày tải lên: 19/02/2014, 05:20

... mutants of LPX1 have an aberrant morphology characterized by intraperoxisomal vesicles or invaginations. Abbreviations BPC, 1,2-bis-(4,4-difluoro-5,7-dimethyl-4-bora- 3a, 4a- diaza-sindacene-3-undecanoyl)-sn-glycero-3-phosphocholine ... 1,2-bis-(4,4-difluoro-5, 7- dimethyl-4-bora- 3a, 4a- diaza-sindacene-3-undecanoyl )- sn-glycero-3-phosphocholine (bis-BODIPY-FL C 11 -PC, BPC). BPC is a...

Ngày tải lên: 07/03/2014, 05:20

... TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TT...

Ngày tải lên: 16/03/2014, 01:20

... analyti- cal tools for giant sequoia, are actually being applied at AFOCEL to other prom- ising forest species in order to enhance their ability for true-to-type cloning. References Bon ... This rejuvenation has been maintained for more than 2 yr for in vitro as well as for outdoor cultivated rooted cuttings. In ad- dition, the rejuvenated...

Ngày tải lên: 09/08/2014, 02:21

... relevant human interaction based on an Head and neck plan evaluation for (a) ANFIS and (b) human planFigure 5 Head and neck plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in ... (principal component analysis and isomap method) Brain plan evaluation for (a) ANFIS and (b) human planFigure 7 Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are show...

Ngày tải lên: 09/08/2014, 10:20

... managers and data analysts. Finally, data analysts were involved in two separate day- long training sessions for each release phase of EYeMap. Following the first training day, analysts were able ... data ana- lyst and one manager). Initially, twelve OEYC data ana- lyst/manager dyads were asked to participate and four declined. The reasons given for declining included vacan- cies in t...

Ngày tải lên: 11/08/2014, 05:22

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and dedu...

Ngày tải lên: 11/08/2014, 11:21

... S, et al: Rates of virological failure in patients treated in a home-based versus a facility-based HIV-care model in Jinja, southeast Uganda: a cluster-randomised equivalence trial. The Lancet 2009, ... the legis- lation is often ill-drafted and may for instance: acciden- tally criminalise conception (e.g. Guinea-Conakry, Guinea-Bissau, Mali, Niger, Kenya); breach medical con- f...

Ngày tải lên: 11/08/2014, 14:21

... Selina Schmocker - sschmocker@mtsinai.on.ca; Mark Fruitman - mark.fruitman@gmail.com; Laurent Milot - laurent.milot@sunnybrook.ca; Anna R Gagliardi - anna.gagliardi@uhnresearch.ca; Andy J Smith - ... that will be required to achieve this negative margin [7]. To date, magnetic resonance imaging (MRI) is widely available and an accurate imaging modality for rectal can- c...

Ngày tải lên: 11/08/2014, 16:20