báo cáo khoa học: " Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation" doc

... this article as: Chakrapani et al .: Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation. Harm ... them.Lack of availability of sterile needles/syringes insideprisons, in spite of the availability of injecting drugs in prisons, means that sharing of needles/syringes amonginmates is common. As ... syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigationVenkatesan Chakrapani1, Peter A Newman2*, Murali Shunmugam1 and Robert Dubrow3AbstractBackground:...

báo cáo khoa học: " Distributing foil from needle and syringe programmes (NSPs) to promote transitions from heroin injecting to chasing: An evaluation" ppt

... lead to a large number of local and systemic bacterial and fungal infections [2]. Injecting also causes soft tissue injuries and often leads to long-termphysical damage such as collapsed veins ... had full responsibility for its oper-ational management and data collection and collaboratedequally with drafting the paper, NH managed the dataanalysis and collaborated equally with drafting ... to broader culturalchanges away from injecting. Recently, countries such asthe Netherlands and Spain have seen marked shifts awayfrom injecting to chasing [17,18]. Such trends are certainto...

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebraﬁsh (Danio rerio) doc

... and Tyr218(Fig. 2). The functional importance of invariant aminoacids of the corresponding alpha-helical C-terminalglobular domain of human PrPCcan be demonstratedwith Pro102, Ala117, and ... organs.Materials and methods AnimalsAdult zebraﬁsh (Danio rerio) were purchased from localcommercial sources. Embryos and larvae were obtained bynatural mating and raised at 28.5 °C, as described ... expression in zebraﬁsh embryo and larva. Int JDev Neurosci 19, 569–587.38 Andre´M, Ando S, Ballagny C, Durliat M, Poupard G,Briancon C & Babin PJ (2000) Intestinal fatty acidbinding protein...

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... containing a complete x-5 gliadin gene, oligonucleo-tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGATG-3¢, were constructed based on fragment DNA sequences of ... Foster City, CA, USA).Expression and puriﬁcation of recombinantproteinSense (5¢-ATTTCATATGCAACAACAATTCCCCCAGCAACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCATAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... extraction Kit (Takara Bio Inc.,Shiga, Japan). PCR was performed using KOD DNA polym-erase (Toyobo, Osaka, Japan) and DNA AMPLIFIERMIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag-ments...

Báo cáo khoa học: Molecular cloning, expression analysis and functional conﬁrmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... body(WB) at day 4 in the last larval instar, in theINT at day 0, 2, 4, 6 and 8 in the last larvalinstar, and in the adult male WB (#), femaleWB ($), testis TES and ovary (OVA), and L. decemlineata ... CTCCCGGCAAGCGTAAGACAAATC3¢-RACELdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAGLdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCCT. Ogura et al. Molting ... receptor and ultraspiracle fromthe Colorado potato beetle Leptinotarsa decemlineataTakehiko Ogura1, Chieka Minakuchi1,*, Yoshiaki Nakagawa1, Guy Smagghe2 and Hisashi Miyagawa11 Division of...

Báo cáo khoa học: Dehydroepiandrosterone inhibits the proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism pptx

... DHEA caninduce early and late apoptosis and also necrosis.DiscussionDHEA is an intermediate in the biosynthesis of andro-gen and estrogen hormones. It was originally isolatedfrom the adrenal ... cultureCASKI, HeLa and C3 3A cells were purchased from theAmerican Type Culture Collection (Manassas, VA, USA).CASKI and HeLa cell lines were maintained in RPMI-1640medium and C3 3A cells in Dulbecco’s ... hyperplastic and premalignant (carcinoma in situ) lesions in mam-mary gland of rats are associated with increasedexpression of p16 and p21, but not p53, implying a p53-independent mechanism of action [31]....

Báo cáo khoa học: Advanced glycation end products and lipopolysaccharide synergistically stimulate proinﬂammatory cytokine⁄chemokine production in endothelial cells via activation of both mitogen-activated protein kinases and nuclear factor-jB pdf

... (forward, 5¢-AGGGTTGCC AGATGCAATAC-3¢;reverse, 5¢-ACACAGCTGGCAATGACAAG-3¢), MCP-1(forward, 5¢-GTGAGGAGCCACCAACATTT-3¢; reverse,5¢-GGGGGATCCCAAGTACTGTT-3¢) and GAPDH (for-ward, 5¢-CCCATCACCATCTTCCAGGA-3¢; ... attenuation in proinﬂammatory cyto-kine ⁄ chemokine production, indicating that the p38pathway acts predominately in the AGE-HSA and LPS ampliﬁed in ammatory response and, thus, mayserve as a main ... and aggravation of the disease.It is well established that proinﬂammatory media-tors initiate a cytokine⁄ chemokine storm by activatingthe intracellular signaling pathways, including MAPkinases...

Báo cáo khoa học: "Synchronous infiltrating ductal carcinoma and primary extramedullary plasmacytoma of the breast" pot

... multiple myeloma.The circulating paraproteins vary in type and includekappa and lambda light-chain patterns, IgA and IgG [4]. In this patient paraproteins were absent in serum and urine, but strongly ... involved in pathological diagnosis and figures, wrote the pathological part of the manuscript.XBR was involved in treatment planning of the patient and manuscript preparation. All authors read and approved ... reported, a causal rela-tionship between synchronous extramedullaryplasmacytoma and infiltrating ductal carcinoma of thebreast must remain speculative.ConsentPatient's permission was obtained...

báo cáo khoa học: "Note Selection for increased and decreased total number of young born in the first three parities in mice" doc

... between laboratory and farm animals. That practice which is usual in experiments with mice avoids thenegative covariance between litter size of daughter and dam (VANGEN, 1981). ... as a result of selection for litter size have beengenerally moderate or small and only in a few cases a high correlated response wasobtained (JOAKIMSEN & BAKER, ... correlation betweenincreased ovulation rate and the duration of estrus in sheep and DALTON & RAE (1978)reported (in a general review) a high genetic correlation between...

báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx

... audio taped, transcribed verbatim, and analysedaccording to a systematic approach.Results: All possible barriers and facilitators were obtained from questionnaire data, indicating that the ... equipment,or manual handling aids), and organisational ergonomicmeasures that were aimed at changing the syst em level(i.e., pau se software installation, job rotati on, or restruc-turing management ... barriers and facili-tators for the process and implementation of a PE pro-gramme and classified them into 19 ca tegories (e.g.,resource availability, creation of an appropriate t eam, and sufficient...

Xem thêm

Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ