báo cáo khoa học: " Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation" doc

báo cáo khoa học: " Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation" doc

báo cáo khoa học: " Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation" doc

... this article as: Chakrapani et al .: Social-structural contexts of needle and syringe sharing behaviours of HIV-positive injecting drug users in Manipur, India: a mixed methods investigation. Harm ... them. Lack of availability of sterile needles/syringes inside prisons, in spite of the availability of injecting drugs in prisons, means that...

Ngày tải lên: 11/08/2014, 18:20

10 272 0
báo cáo khoa học: " Distributing foil from needle and syringe programmes (NSPs) to promote transitions from heroin injecting to chasing: An evaluation" ppt

báo cáo khoa học: " Distributing foil from needle and syringe programmes (NSPs) to promote transitions from heroin injecting to chasing: An evaluation" ppt

... lead to a large number of local and systemic bacterial and fungal infections [2]. Injecting also causes soft tissue injuries and often leads to long-term physical damage such as collapsed veins ... had full responsibility for its oper- ational management and data collection and collaborated equally with drafting the paper, NH managed the data analysis and collaborated equall...

Ngày tải lên: 11/08/2014, 18:20

8 271 0
Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc

Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc

... and Tyr218 (Fig. 2). The functional importance of invariant amino acids of the corresponding alpha-helical C-terminal globular domain of human PrP C can be demonstrated with Pro102, Ala117, and ... organs. Materials and methods Animals Adult zebrafish (Danio rerio) were purchased from local commercial sources. Embryos and larvae were obtained by natural mating and raised at 2...

Ngày tải lên: 19/02/2014, 16:20

14 548 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... containing a complete x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA sequences of ... Foster City, CA, USA). Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGC...

Ngày tải lên: 20/02/2014, 01:20

8 484 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis TES and ovary (OVA), and L. decemlineata ... CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC T....

Ngày tải lên: 07/03/2014, 21:20

15 564 0
Báo cáo khoa học: Dehydroepiandrosterone inhibits the proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism pptx

Báo cáo khoa học: Dehydroepiandrosterone inhibits the proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism pptx

... DHEA can induce early and late apoptosis and also necrosis. Discussion DHEA is an intermediate in the biosynthesis of andro- gen and estrogen hormones. It was originally isolated from the adrenal ... culture CASKI, HeLa and C3 3A cells were purchased from the American Type Culture Collection (Manassas, VA, USA). CASKI and HeLa cell lines were maintained in RPMI-1640 medium a...

Ngày tải lên: 16/03/2014, 00:20

12 534 0
Báo cáo khoa học: Advanced glycation end products and lipopolysaccharide synergistically stimulate proinflammatory cytokine⁄chemokine production in endothelial cells via activation of both mitogen-activated protein kinases and nuclear factor-jB pdf

Báo cáo khoa học: Advanced glycation end products and lipopolysaccharide synergistically stimulate proinflammatory cytokine⁄chemokine production in endothelial cells via activation of both mitogen-activated protein kinases and nuclear factor-jB pdf

... (forward, 5¢-AGGGTTGCC AGATGCAATAC-3¢; reverse, 5¢-ACACAGCTGGCAATGACAAG-3¢), MCP-1 (forward, 5¢-GTGAGGAGCCACCAACATTT-3¢; reverse, 5¢-GGGGGATCCCAAGTACTGTT-3¢) and GAPDH (for- ward, 5¢-CCCATCACCATCTTCCAGGA-3¢; ... attenuation in proinflammatory cyto- kine ⁄ chemokine production, indicating that the p38 pathway acts predominately in the AGE-HSA and LPS amplified in ammatory response and,...

Ngày tải lên: 30/03/2014, 01:20

9 409 0
Báo cáo khoa học: "Synchronous infiltrating ductal carcinoma and primary extramedullary plasmacytoma of the breast" pot

Báo cáo khoa học: "Synchronous infiltrating ductal carcinoma and primary extramedullary plasmacytoma of the breast" pot

... multiple myeloma. The circulating paraproteins vary in type and include kappa and lambda light-chain patterns, IgA and IgG [4]. In this patient paraproteins were absent in serum and urine, but strongly ... involved in pathological diagnosis and figures, wrote the pathological part of the manuscript. XBR was involved in treatment planning of the patient and manuscript...

Ngày tải lên: 09/08/2014, 04:21

3 210 0
báo cáo khoa học: "Note Selection for increased and decreased total number of young born in the first three parities in mice" doc

báo cáo khoa học: "Note Selection for increased and decreased total number of young born in the first three parities in mice" doc

... between laboratory and farm animals. That practice which is usual in experiments with mice avoids the negative covariance between litter size of daughter and dam (V ANGEN , 1981). ... as a result of selection for litter size have been generally moderate or small and only in a few cases a high correlated response was obtained (J OAKI...

Ngày tải lên: 09/08/2014, 22:22

8 287 0
báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx

báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx

... audio taped, transcribed verbatim, and analysed according to a systematic approach. Results: All possible barriers and facilitators were obtained from questionnaire data, indicating that the ... equipment, or manual handling aids), and organisational ergonomic measures that were aimed at changing the syst em level (i.e., pau se software installation, job rotati on, or restruc- turing...

Ngày tải lên: 10/08/2014, 10:23

9 293 0
Từ khóa:
w