Báo cáo y học: "Chest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case report" doc

Báo cáo y học: "Chest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case report" doc

Báo cáo y học: "Chest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case report" doc

... report Open Access Chest wall resection and reconstruction using titanium micromesh covered with Marlex mesh for metastatic follicular thyroid carcinoma: a case report Nobuyasu Suganuma*, Nobuyuki Wada, ... Hiromasa Arai, Hirotaka Nakayama, Keita Fujii, Katsuhiko Masudo, Norio Yukawa, Yasushi Rino, Munetaka Masuda and Toshio Imada Address: Department of S...

Ngày tải lên: 11/08/2014, 17:21

4 172 0
Báo cáo y học: "Chest wall mechanics during pressure support ventilation" ppsx

Báo cáo y học: "Chest wall mechanics during pressure support ventilation" ppsx

... EC and DC performed the study and carried out data collection. AA, PP and LG drafted the manuscript. AA and EC performed the statistical analysis. AA, PP, RD, AP and LG conceived the study and ... rib cage muscles and expiratory action of the abdominal muscles; and the phase shift between rib cage and abdominal compartments. Ventilatory pattern, gas exchange and respirator...

Ngày tải lên: 12/08/2014, 23:23

10 304 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13]. This method recorded COP data and analysed COP traces using an image analyser ... an unhealthy or less desirable control strategy. The analysis of fractal patterns in gait and posture data may serve as an indicator of pathology or impairment. Surrogate data analy...

Ngày tải lên: 03/11/2012, 10:09

10 458 0
Báo cáo y học: "Simultaneous sleep study and nasoendoscopic investigation in a patient with obstructive sleep apnoea syndrome refractory to continuous positive airway pressure: a case report" ppt

Báo cáo y học: "Simultaneous sleep study and nasoendoscopic investigation in a patient with obstructive sleep apnoea syndrome refractory to continuous positive airway pressure: a case report" ppt

... had low alcohol consumption (10 gr/day) and no history of smoking. A physical exam revealed macroglossia, a bulky soft palate and uvula. He was overweightwithabodymassindex(BMI)of29. 1and had a ... upper airway surgery (especially bi-maxi llary advancement) may also be considered. Case presentation: We report the case of a 38-year-old Caucasian man with severe obstructive s...

Ngày tải lên: 11/08/2014, 14:21

7 359 1
Báo cáo y học: " Symptoms of epilepsy and organic brain dysfunctions in patients with acute, brief depression combined with other fluctuating psychiatric symptoms: a controlled study from an acute psychiatric department" potx

Báo cáo y học: " Symptoms of epilepsy and organic brain dysfunctions in patients with acute, brief depression combined with other fluctuating psychiatric symptoms: a controlled study from an acute psychiatric department" potx

... acute psychiatric condi- tions are admitted each year. Norwegian acute psychiatric services are public and available to everyone. All the patients in the catchment area are admitted to this depart- ment. ... cerebelli. At clinical neurological examination, three AUDS patients and one control patient had signs of CNS pathology. One AUDS patient had ophtalmoplegia and bilaterally inverted...

Ngày tải lên: 11/08/2014, 17:20

6 279 0
Báo cáo y học: " Serodiagnosis of sheeppox and goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen P32" ppt

Báo cáo y học: " Serodiagnosis of sheeppox and goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen P32" ppt

... μgAand0.1μg B). The optimal antibody * Correspondence: hnxiangtao@163.com Key Laboratory of Animal Virology of Ministry of Agriculture, State Key Laboratory of Veterinary Etiologic Biology, Lanzhou ... specificity and sensitivity. The a ssay also had good repeatability and promises to be useful in clinical contexts. In summary, the I-ELISA established here was sensi- tive and specific...

Ngày tải lên: 12/08/2014, 01:22

4 323 0
Báo cáo y học: "Extra-cellular release and blood diffusion of BART viral micro-RNAs produced by EBV-infected nasopharyngeal carcinoma cells" pps

Báo cáo y học: "Extra-cellular release and blood diffusion of BART viral micro-RNAs produced by EBV-infected nasopharyngeal carcinoma cells" pps

... plasma samples. BV, JG, PL and ST participated in the collection of clinical samples. VS and CA have assayed viral DNA load in plasma samples and assessed anti-VCA and -EBNA antibodies. SB has ... with a rat monoclo nal antibody (Stressgen, Ann Harbor, MI) and b-actin was visualized using a monoclonal antibody (AC-74) from Sigma Aldrich (St. Louis, MO). Collection, separatio...

Ngày tải lên: 12/08/2014, 01:22

12 341 0
Báo cáo y học: " Full genome comparison and characterization of avian H10 viruses with different pathogenicity in Mink (Mustela vison) reveals genetic and functional differences in the non-structural gene" pot

Báo cáo y học: " Full genome comparison and characterization of avian H10 viruses with different pathogenicity in Mink (Mustela vison) reveals genetic and functional differences in the non-structural gene" pot

... ATATCGTCTCGTATTAGTAGAAACAAGGCATTT PA PA-F1 TATTCGTCTCAGGGAGCGAAAGCAGGTAC PA-R1 TNGTYCTRCAYTTGCTTATCAT PA-F2 CATTGAGGGCAAGCTTTC PA-R2 ATATCGTCTCGTATTAGTAGAAACAAGGTACTT HA HA-F1 GCAAAGCAGGGGTCACAATGTCA HAR1 ... TCTGAATCAGCCATGTCAATTGT HA-F2 GATTTCCATTGGACGATGGTACAACCA HA-R2 GGGTGTTTTTAACTAAATACAGATTGTGC NP NP-1F AGCRAAAGCAGGGTDKATA NP-1R CYARTTGACTYTTRTGTGCTGG NP-2F TAYGACTTTGARAGAGAAGG NP-2R A...

Ngày tải lên: 12/08/2014, 04:20

11 393 0
Báo cáo y học: "Bone mineral density and body composition in postmenopausal women with psoriasis and psoriatic arthritis" doc

Báo cáo y học: "Bone mineral density and body composition in postmenopausal women with psoriasis and psoriatic arthritis" doc

... and femur BMD and fat mass after treat- ment with etanercept and infliximab in AS patients [19]. Saraceno and Gis ondi demonstrated an increase of body weight in Ps and PsA patients treated with ... MMP participated in study design, analyzed bone scan DXA as well as spine X-ray for radiographic fractures, interpreted and analyzed the data and helped to draft the manuscript...

Ngày tải lên: 12/08/2014, 15:22

7 345 0
Báo cáo y học: "Patient throughput times and inflow patterns in Swedish emergency departments. A basis for ANSWER, A National SWedish Emergency Registry" ppt

Báo cáo y học: "Patient throughput times and inflow patterns in Swedish emergency departments. A basis for ANSWER, A National SWedish Emergency Registry" ppt

... Sweden, and forms the basis for ANSWER. In the studied six EDs, Monday was the busiest and Sa turday the least busy day. All EDs had a large increase in patient inflo w before noon and a slow ... conception and design of the study, data interpretation and critically revised the manuscript. FE and PT collected and analyzed the data and critically revised the manuscript. F...

Ngày tải lên: 13/08/2014, 23:20

10 270 0
Từ khóa:
w