Báo cáo y học: " Clinical presentation and endoscopic features of primary gastric Burkitt lymphoma in childhood, presenting as a protein-losing enteropathy: a case report" pptx

... Case report Open Access Clinical presentation and endoscopic features of primary gastric Burkitt lymphoma in childhood, presenting as a protein-losing enteropathy: a case report Jenny Hui ... on rare occasions can include gastric mucosa. A case of primary gastric Burkitt lymphoma is described in a child presenting as a protein...

Ngày tải lên: 11/08/2014, 17:21

... University of California Santa Cruz (UCSC) Genome Browser, the Vega Genome Browser and an integrated database of human genes and trans- cripts (H-Invitational Database): one finds an average overlap ... blueprint of a phenotype, but rather a well-scrambled message, in which functionally relevant sequences are lost in a sea of phenotypically neutral information. A s...

Ngày tải lên: 09/08/2014, 20:22

... CTGTGAGAGGAGGTGGAGAG IL-6 NM_001009392 598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCA IL-8 NM_001009401 438–520 CCTCAGTAAAGATGCCAATGA TGACAACCCTACACCAGACC 18S X01117 1495–1673 GTCTGTGATGCCCTTAGATGTC ... embedded in paraffin. Paraffin blocks were randomly selected and 5 μm sections were incubated at 60°C for 2 h, deparaffinised in xylene, rehy- drated using graded alcohol washes and...

Ngày tải lên: 12/08/2014, 14:20

... Bian Ying, Viroj Tangcha- roensathien, Walaiporn Patcharanarumol, Jiangbo Bao, Aparnaa Somanathan, Elena Potaptchik and Ruth Lucio and Benjamin Nganda for their efforts in gathering cost data ... determi- nants, some unexplained variability remained, possibly linked to variables that we could not measure including quality of care, case mix and salary differentials for staff work...

Ngày tải lên: 13/08/2014, 11:22

... anti-inflammatory and pro-inflammatory effects may be considered as the Yin and Yang actions of ginseng. Background Ginseng is a perennial herb of the Araliaceae family. Asian ginseng (Panax ginseng C .A. Meyer, ... by ginsenoside Rg3 of bombesin-enhanced peritoneal metastasis of intestinal adenocarcinomas induced by azoxymethane in wistar rats. Clin Exp Metastasis 1997, 15:...

Ngày tải lên: 13/08/2014, 14:20

... Educational attainmentwasusedasameasurefor SES, as educational attainment is easy to measure and is fairly stable beyond early adulthood, and higher levels of education are usually associated ... than the prevalence found in Australia [17], the USA [23], and European countries (e.g. Scotland, France, Portugal, ) [29]. As Flanders in Belgian has a mild sea climate, a flat l...

Ngày tải lên: 14/08/2014, 08:20

... up and conduct, data collec- tion and analysis, drafting and writing of the manuscript. AK participated in the conception of the study, study set up and data analysis. TP participated in study ... conduct, data collection, data cleaning and manuscript writing. MW was involved in the conception of the study, data analysis and drafting of the manuscript. BHP participat...

Ngày tải lên: 20/06/2014, 08:20

... BUN. One-way analysis of variance (Anova) was use d to compare values at base line, initiation of ART, 2 weeks of ART, 4 weeks of ART, termination of ART, and end of study (Table 2 and Figure ... disease Longitudinal changes in serum chemistry were exam- ined at different stages of disease and treatment and revealed an initial increase in BUN and creatinine and d...

Ngày tải lên: 10/08/2014, 05:21

... Subungual melanoma: a particularly invasive “onychomycosis”. J Am Geriatr Soc 2007, 55:2094-2096. 27. Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata ... nail unit melanoma (NUM); longitudinal melanonychia and amelanotic tumours (Figure 3). The first may be associated with alteration of nail plate anatomy in more advanced cases. Th...

Ngày tải lên: 10/08/2014, 21:24

... social and occupational functioning, an episode in the last 2 years, history of rapid cycling, and the caregiver being responsible for medication intake explained a quarter of the variance of ... JML have received reimbursements, fees, and funding from AstraZeneca for participating in clinical studies and advisory boards. MMM and EM are employees of AstraZeneca at th...

Ngày tải lên: 11/08/2014, 15:22