Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
... of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report Philip A Verhoef* 1,2 and Angelika Rampal 2 Address: 1 Department of Internal Medicine, ... patient with anorexia nervosa and superior mesenteric artery syndrome. Case presentation: We report the case of a 16-year-old Caucas...
Ngày tải lên: 11/08/2014, 17:21
... cause an abrupt decrease in platelet count with restart- ing of heparin treatment [8]. For laboratory diagnosis of HIT a ntibodies, antigen assays as well as functional assays (platelet activation) are ... pharmacodynamic parameters of argatroban and that argatroban is well tolerated and prov ides adequate anti coagulation in patient s with renal dysfunction or failure as...
Ngày tải lên: 13/08/2014, 20:22
... report of 15 cases. Hepatobilliary Pancreat Dis Int. 2008;7(2):196-200. 10. Yu CC, Yeh CN, Hwang TL, Jan YY. Clinicopathological study of solid and pseudopapillary tumor of pancreas: Emphasis ... was the predominant complaint (8/18). The rest of the patients were asymptomatic and presented with a pancreatic mass detected incidentally. Radiological study revealed a well-demarc...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: " Exercise therapy for the management of osteoarthritis of the hip joint: a systematic review" pot
... physiotherapy evidence database; PsycINFO: abstract database of psychological literature; VAS: visual analogue scale; VO 2: the total amount of oxygen that the body needs and takes in; WOMAC: ... Treatments are typically directed at the management of symptoms, such as pain relief and improving function, with exercise therapy being commonly used as a treatment modality. Recen...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Knowledge transfer for the management of dementia: a cluster-randomised trial of blended learning in general practice" docx
... management and an evaluation form [33]. Study arm A and B All participants were asked to complete a further knowl- edge test about dementia management that was sent by post after six months as ... Plumb L, Macfarlane F: Transferability of principles of evidence based medicine to improve educational quality: systematic review and case study of an online course in primary heal...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: " Low central venous saturation predicts poor outcome in patients with brain injury after major trauma: a prospective observational study" pot
... the use of ScvO 2 as a target of resuscitation in patients with brain injury after major trauma. The validation of ScvO 2 in monitoring of cerebral metabolism and as a target for hemodynamic resuscitation ... collectors. Patients has been anonymized, thus privacy was guaran- tee. Severity of disease was estimated by the Simplified Acute Physiology Score II (SAPS II) [11]...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: "New methodology for specific inhalation challenges with occupational agents" pdf
... with occupational agents that can allow for all types of generation within the same instrument. We also assessed the feasibility of its use by hereby presenting the results of challenges (stability ... were: 1) lactose, if the causal agent was in a dry aerosol; 2) N-butyl acetate, if the causal agent was in an aerosol or vapor form. The project was accepted by the Ethics Committ...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"
... 18. Kashiwagi S, Hayashi J, Nomura H, at al. Changing pattern of intrafamilial transmission of hepatitis B virus in Okinawa, Japan. Am J Epidemiol 1988; 127: 783-787 Tables Table 1. Rate ratio ... for birthplace, age and calendar year, and interactions between birthplace and age, birthplace and calendar year. Figure 1. Annual rates of newly identified cases among children with...
Ngày tải lên: 02/11/2012, 11:08
Tài liệu Báo cáo Y học: Systematic search for zinc-binding proteins in Escherichia coli potx
... (fructose-1,6-bisphosphatase aldo- lase), LpdA (lipoamide dehydrogenase), Ppa (inroganic pyrophosphatase), Pta (phosphotransacetylase) and RpoA (RNA polymerase a subunit) (compare Tables 1 and 2). Because the ... hydroxymethyltransferase 5 LpdA* (AtpA) Lipoamide dehydrogenase (F1 ATP synthase a subunit) 6 Ppa* (AhpC) Inorganic pyrophosphatase (alkyl hydroperoxide reductase C22) 7 Pta* Pho...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx
... (iPsbW and sPsbW). For iPsbW, the forward and reverse primers were ATGGG TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA CGCG, respectively. For sPsbW, the forward and reverse primers were ATGGAGACAAAGCAAGGAAAC ... maturation and negative charges in particular appear to be favored. In the case of PsbY -A2 , the negative charge in the translocated loop plays a key role in defining the hydrophobic...
Ngày tải lên: 18/03/2014, 01:20