Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
... of a 16-year-old girl
with superior mesenteric artery syndrome as a result of anorexia
nervosa: a case report
Philip A Verhoef*
1,2
and Angelika Rampal
2
Address:
1
Department of Internal Medicine, ... patient with anorexia nervosa and superior
mesenteric artery syndrome.
Case presentation: We report the case of a 16-year-old Caucas...
Báo cáo y học: "Argatroban therapy for heparin-induced thrombocytopenia in ICU patients with multiple organ dysfunction syndrome: a retrospective study" pps
... cause an abrupt decrease in platelet count with restart-
ing of heparin treatment [8].
For laboratory diagnosis of HIT a ntibodies, antigen
assays as well as functional assays (platelet activation)
are ... pharmacodynamic parameters
of argatroban and that argatroban is well tolerated and
prov ides adequate anti coagulation in patient s with renal
dysfunction or failure as...
Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"
... report of 15 cases.
Hepatobilliary Pancreat Dis Int. 2008;7(2):196-200.
10. Yu CC, Yeh CN, Hwang TL, Jan YY. Clinicopathological study
of solid and pseudopapillary tumor of pancreas: Emphasis ... was the
predominant complaint (8/18). The rest of the patients were asymptomatic and presented
with a pancreatic mass detected incidentally. Radiological study revealed a well-demarc...
Báo cáo y học: " Exercise therapy for the management of osteoarthritis of the hip joint: a systematic review" pot
... physiotherapy evidence database; PsycINFO: abstract
database of psychological literature; VAS: visual analogue scale; VO
2:
the total amount of oxygen that the body needs and takes in; WOMAC: ... Treatments are typically
directed at the management of symptoms, such as pain relief
and improving function, with exercise therapy being commonly
used as a treatment modality.
Recen...
Báo cáo y học: "Knowledge transfer for the management of dementia: a cluster-randomised trial of blended learning in general practice" docx
... management and an evaluation form [33].
Study arm A and B
All participants were asked to complete a further knowl-
edge test about dementia management that was sent by
post after six months as ... Plumb L, Macfarlane F:
Transferability of principles of evidence based medicine to improve
educational quality: systematic review and case study of an online
course in primary heal...
Báo cáo y học: " Low central venous saturation predicts poor outcome in patients with brain injury after major trauma: a prospective observational study" pot
... the
use of ScvO
2
as a target of resuscitation in patients with
brain injury after major trauma. The validation of ScvO
2
in monitoring of cerebral metabolism and as a target for
hemodynamic resuscitation ... collectors.
Patients has been anonymized, thus privacy was guaran-
tee. Severity of disease was estimated by the Simplified
Acute Physiology Score II (SAPS II) [11]...
Báo cáo y học: "New methodology for specific inhalation challenges with occupational agents" pdf
... with occupational agents that can allow for all
types of generation within the same instrument. We also
assessed the feasibility of its use by hereby presenting the
results of challenges (stability ... were: 1) lactose, if the causal agent was in a dry
aerosol; 2) N-butyl acetate, if the causal agent was in an
aerosol or vapor form.
The project was accepted by the Ethics Committ...
Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"
...
18. Kashiwagi S, Hayashi J, Nomura H, at al. Changing pattern of
intrafamilial transmission of hepatitis B virus in Okinawa, Japan. Am J
Epidemiol 1988; 127: 783-787
Tables
Table 1. Rate ratio ... for birthplace, age and calendar year, and
interactions between birthplace and age, birthplace and calendar year.
Figure 1. Annual rates of newly identified cases among children
with...
Tài liệu Báo cáo Y học: Systematic search for zinc-binding proteins in Escherichia coli potx
... (fructose-1,6-bisphosphatase aldo-
lase), LpdA (lipoamide dehydrogenase), Ppa (inroganic
pyrophosphatase), Pta (phosphotransacetylase) and RpoA
(RNA polymerase a subunit) (compare Tables 1 and 2).
Because the ... hydroxymethyltransferase
5 LpdA* (AtpA) Lipoamide dehydrogenase
(F1 ATP synthase a subunit)
6 Ppa* (AhpC) Inorganic pyrophosphatase
(alkyl hydroperoxide reductase C22)
7 Pta* Pho...
Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx
... (iPsbW and sPsbW).
For iPsbW, the forward and reverse primers were ATGGG
TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA
CGCG, respectively. For sPsbW, the forward and reverse
primers were ATGGAGACAAAGCAAGGAAAC ... maturation and negative
charges in particular appear to be favored. In the case of
PsbY -A2 , the negative charge in the translocated loop plays
a key role in defining the hydrophobic...
Từ khóa: