Báo cáo y học: "Helping someone with problem drinking: Mental health first aid guidelines - a Delphi expert consensus study" pdf
... Survey Initiative. World Psychiatry 2007:17 7-1 85. 7. Kitchener BA, Jorm AF: Mental Health First Aid Manual Canberra: Cen- tre for Mental Health Research, The Australian National University; 2002. ... drinking: Mental health first aid guidelines - a Delphi expert consensus study Anna H Kingston, Anthony F Jorm, Betty A Kitchener, Leanne Hides, Claire...
Ngày tải lên: 11/08/2014, 17:20
... the early help provided to some- one developing a mental disorder, as well as assistance during mental health crisis situations. The MHFA program teaches first aid for a variety o f mental health problems, ... Girolamo G, Fayyad J, Gureje O, Haro JM, Huang YQ, et al: Delay and failure in treatment seeking after first onset of mental disorders in the World Health Organi...
Ngày tải lên: 11/08/2014, 16:22
... esa.aromaa@vshp.fi 1 Vaasa Hospital District and National Institute for Health and Welfare, Psychiatric Unit of Vaasa Central Hospital, Sarjakatu 2, Vaasa, FI- 65320, Finland Full list of author ... [31,32]. Finally, social desir- ability may always have an effect on attitude question- naires. People are likely to underreport their stigmatizing stereotypes compared with their real -life b...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Mimotopes selected with neutralizing antibodies against Multiple Subtypes of Influenza A" pot
... sequence and nucleotide sequence of multi-mimotope of influenza A E T K A W W L G S G G S Q A H N W Y N H K P L P G S G gaaactaaagcatggtggctgggttctggtggttctcaggctcataactggtataaccataagccactgccaggttccggt ... Ph.D. -7 , Ph.D. -1 2 and Ph.D. -C7C peptide phage-display libraries. a: Phage clones from Ph.D. –7 peptide phage-display library. b: Phage clones from Ph.D. –12 peptide p...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... erik.zakariassen@isf.uib.no 1 National Centre for Emergency Primary Health Care, Uni Health, Bergen, Norway, Kalfarveien 31, 5018 Bergen, Norway Zakariassen et al. Scandinavian Journal of Trauma, ... possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Med...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Can physical activity improve the mental health of older adults" pps
... Medicine and Pharmacology, University of Western Australia, Perth, Australia Email: Nicola T Lautenschlager - nicolal@cyllene.uwa.edu.au; Osvaldo P Almeida - osvalm@cyllene.uwa.edu.au; Leon ... Flicker - leon.flicker @health. wa.gov.au; Aleksandar Janca* - ajanca@cyllene.uwa.edu.au * Corresponding author Abstract The world population is aging rapidly. Whilst this dramatic d...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "Optimal search strategies for identifying mental health content in MEDLINE: an analytic survey" ppt
... strategies that can help dis- criminate the literature with mental health content from articles that do not have mental health content. General practitioners, mental health practitioners, and researchers wanting ... Psychiatry Open Access Primary research Optimal search strategies for identifying mental health content in MEDLINE: an analytic survey Nancy L Wilczynski* 1 , R...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Deep transcranial magnetic stimulation for the treatment of auditory hallucinations: a preliminary open-label study" pptx
... Center and head of the electroconvulsive therapy unit of the Beer Ya’akov Mental Health Center. PD is paid by by Beer Ya’akov Mental Health Center. YR works as a research consultant for Brainsway. Competing ... Beer Ya’akov Mental Health Center and is paid by the research fund of the Beer Ya’akov Mental Health Center. KM serves as the director of the Beer Ya’akov Mental H...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... interval; CIITA = class II transactivator; CRP = C-reactive protein; GGP = geranylgeranyl pyrophosphate; HMG-CoA = 3-hydroxy- 3-methylglutaryl-coenzyme A; HUVEC = human umbilical-vein endothelial ... Hakamada-Taguchi R, Uehara Y, Kuribayashi K, Numabe A, Saito K, Negoro H, Fujita T, Toyo-oka T, Kato T: Inhibition of hydrox- ymethylglutaryl-coenzyme a reductase reduces Th1 develop- ment a...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Insulin resistance, adiponectin and adverse outcomes following elective cardiac surgery: a prospective follow-up study" docx
... insulin resistance nor adiponectin were statistically significantly associated with 30-day mortality, but adiponectin was associated with an increased 3 1-3 65-d ay mortality (adjusted odds ratio 2.9 ... Shimomura I, Sata M, Arita Y, Nishida M, Maeda N, Kumada M, Okamoto Y, Nagaretani H, Nishizawa H, Kishida K, Komuro R, Ouchi N, Kihara S, Nagai R, Funahashi T, Matsuzawa Y: Role of a...
Ngày tải lên: 10/08/2014, 09:23