Báo cáo y học: " Low-intensity blue-enriched white light (750 lux) and standard bright light (10 000 lux) are equally effective in treating SAD A randomized controlled study" pps
Báo cáo y học: " Low-intensity blue-enriched white light (750 lux) and standard bright light (10 000 lux) are equally effective in treating SAD. A randomized controlled study" pps
... measures of irritability and eye discomfort as compared to white light of 4000 ° K [29]. Exposure to low-intensity blue-enriched white light (750 lux, 17 000 °K) is equally effective as standard ... Anderson et al. [16], who found that blue monochromatic low-intensity light (98 lux) was equally effective in treating SAD as broad- band white light...
Ngày tải lên: 11/08/2014, 16:23
Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot
... study Rachel A Laws*, Lynn A Kemp, Mark F Harris, Gawaine Powell Davies, Anna M Williams and Rosslyn Eames-Brown Address: Centre for Primary Health Care and Equity, School of Public Health and ... L, Fahridin S, Pan Y, O' Halloran J: General Practice Activity in Aus- tralia 2007-2008 Canberra: AIHW Cat No, GEP 22; 2008. 14. Ferketich AK, Khan Y, Wewers ME: Are physician...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: "CD47 associates with alpha 5 integrin and regulates responses of human articular chondrocytes to mechanical stimulation in an in vitro model" pdf
... glyceraldehyde-3- phosphate dehydrogenase (GAPDH), 5'-CCACCCAT- GGCAAATTCCATGGCA-3' and 5'-TCTAGACGGCAGGT- CAGGTCCACC-3'; and aggrecan, 5'- TGAGGAGGGCTGGAACAAGTACC-3' and 5'-GGAGGT- GGTAATTGCAGGGAACA-3'. A ... to a wide range of mechanical forces in vivo as part of normal joint movement and loading. Mechanical loading within a physiologi...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Effectiveness of strategies to encourage general practitioners to accept an offer of free access to online evidence-based information: a randomised controlled trial" docx
... the Royal Australian Collage of General Practitioner's National Research and Evalua- tion Ethics Committee. Results Age, gender, country of graduation, years since graduation and area of ... and Accessibility/Remoteness Index of Australia (ARIA) were provided by Medicare in table format (to protect GP's pri- vacy). Baseline characteristics (age group, gender, country of grad...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: "Spontaneous internal desynchronization of locomotor activity and body temperature rhythms from plasma melatonin rhythm in rats exposed to constant dim light" docx
... purposes) Introduction Circadian rhythms in physiology and behavior have been described in a wide variety of organisms ranging from bac- teria to humans. These rhythms are driven by circadian pacemakers that are capable ... assay was 0.2 pg/ml. Intra-Assay variability was 9% and the inter-Assay was 13% (see [15] for more details). Analysis of the R w and T b rhythms were perf...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"
... serum creatinine, hematocrit, vital signs, preoperative urine volume, urinary sodium, and urinary creatinine. Vital signs were analyzed using the repeat- ed-measures analysis of variance and the ... ASA physical status classification and, basically, was not the patient ap- propriate for the ORT treatment, and it was probable that hyperinflation of the lung was always present in...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT ... GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTT...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"
... synthetic tri- peptide substrate N-[3-(2-furyl)acryloyl] phenylalanylglcylglcine (FAPGG). FAPGG is hydro- lyzed by ACE to furylacryloylphenylalanine (FAP) and glycylglycine. Hydrolysis of FAPGG ... [8-13]. As a secondary gain, the influences of SX and D on the renin-angiotensin system (RAS), insulin sensitivity, and inflammation were also examined. MATERIAL AND METHODS Protoco...
Ngày tải lên: 26/10/2012, 08:57
Báo cáo y học: "Percutaneous laser disc decompression for thoracic disc disease: report of 10 cases"
... neodymium:ytrium-aluminum garnet laser [Nd:YAG], holmium:ytrium- aluminum-garnet laser [Ho:YAG], and diode laser. Lasers with visible green radiation include double-frequency Nd:YAG laser and potassium-titanyl-phosphate ... herniation causing neural impingement is less common than that in the cervical or lumbar regions. Certain impact injuries, such as parachute landings, can resu...
Ngày tải lên: 26/10/2012, 09:07