Báo cáo y học: " Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online pilot study" ppsx
Báo cáo y học: " Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online pilot study" ppsx
... Statistical analysis includes Kappa analysis, Cronbach’s alpha, Spearman’s correlation analysis, and Confirmatory Factor analysis. Results: Using the recommended cut-off of Zagazig Depression scale ... this article as: Ibrahim et al.: Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online p...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... liver and gallbladder (lane 6), duodenum and intestine (lane 7) and kidney (lane 8) was used. (A) One band of 324 bp is obtained with the couple of primers NAU764 and NAU726. (B) The efficiency of the ... Contigs analysis of the Human Genome Project did not reveal any other mucin on chromosome 3q29 and, interestingly, our analysis allowed the determination of the...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo y học: " Clinical review: Timing and dose of continuous renal replacement therapy in acute kidney injury" ppsx
... After adjustment for age and clinical factors and stratification by site and initial modality of RRT in a multi- variate analysis, the relative risk of death associated with dialysis initiation ... stratified based on the etiology of AKI and randomized in a paired fashion [29]. Patients were enrolled when the serum creatinine reached approximately 8 mg/dl and wer...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo y học: "Long-term outcome and prognosis of dissociative disorder with onset in childhood or adolescence" pot
... the study, performed parts of the statistical analysis and drafted the manuscript. SS–S and TW participated in the design, organization and data collection of the study and performed the statistical ... statistical analysis. AW, CW, HE, and WS participated in the design and coordination of the study and helped to draft the manuscript. All authors read...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "ome-wide prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana" pot
... set in the following analysis (Figure 1a) . For most NAT pairs in the second category of the cDNA-NAT set, only one transcript in each pair matched an annotated gene. This indicates that transcripts ... pairs based on the annotation of their corresponding genes, and 201 genomic-cDNA-NAT pairs, each including a transcript derived from an annotated gene on one strand...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by annealing ... labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTC...
Ngày tải lên: 17/03/2014, 17:20
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
... forward and back-translation was then produced and a final review conducted by the study team. The piloting revealed that all the questions were answered, and there was a good distribution of answers from ... required. Supervision and qual- ity control were provided by the 3 members of the study team and 2 team leaders. Statistical analysis Data quality was assesse...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
... = 12 years) in Poland to 63 (STD = 10 years) in Australia. Patients in Poland, South Africa and the United Kingdom were slightly younger than in Australia, Germany and Hungary. Mean sleep interference ... impairment [15]. The present study examines perceptions of sleep in an international clinical trial aimed at evaluating the efficacy and safety of the pregabali...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo y học: "Residual sleep disturbance and risk of relapse during the continuation/maintenance phase treatment of major depressive disorder with the selective serotonin reuptake inhibitor fluoxetine" docx
... distribution, and reproductio n in any medium, provided the original work is properly ci ted. researchers and clinicians have advocated the impor- tance of treating residual symptoms and of exploring their ... 10.9), and 55.3% were female. Their mean HDRS score was 17.1 (SD = 4.1) at baseline and 4.9 (SD = 3.1) at rando- mization; 22.7% of them had a history of dysth...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Abnormal costimulatory phenotype and function of dendritic cells before and after the onset of severe murine lupus" pot
... the ELISA anti-DNA and analyzed the data. RC participated in the design of the study and helped to draft the manuscript. SG conceived of the study, and participated in its design and coordination, ... phenotype, analyzed the data, and drafted the manuscript. JD performed many of the immunostainings to characterize DC phenotype and analyzed the data. D...
Ngày tải lên: 09/08/2014, 07:20