0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online pilot study" ppsx

Báo cáo y học:

Báo cáo y học: " Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online pilot study" ppsx

... Statistical analysis includes Kappa analysis,Cronbach’s alpha, Spearman’s correlation analysis, and Confirmatory Factor analysis.Results: Using the recommended cut-off of Zagazig Depression scale ... this article as: Ibrahim et al.: Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online pilot study. BMC Psychiatry 2010 10:107.Submit your ... 8 of 10RESEARC H ARTIC LE Open Access Establishing the reliability and validity of the Zagazig Depression Scale in a UK student population: an online pilot studyAhmed K Ibrahim1,2*, Shona...
  • 10
  • 471
  • 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

... liver and gallbladder (lane 6), duodenum and intestine (lane 7) and kidney (lane 8) was used. (A) One band of 324 bp is obtained with the couple of primers NAU764 and NAU726.(B) The efficiency of the ... Contigs analysis of the Human GenomeProject did not reveal any other mucin on chromosome 3q29 and, interestingly, our analysis allowed the determination of the genomic organization of the human MUC4 ... of Muc4 in trachea,duodenum and intestine in contrast with a lower expression in stomach, in salivary glands, in liver and gallbladder, and in kidney. Chromosomal localization, sequence and expres-sion...
  • 10
  • 434
  • 0
Báo cáo y học:

Báo cáo y học: " Clinical review: Timing and dose of continuous renal replacement therapy in acute kidney injury" ppsx

... After adjustment for age and clinical factors and stratification by site and initial modality of RRT in a multi-variate analysis, the relative risk of death associated withdialysis initiation ... stratified based on the etiology of AKI and randomized in a paired fashion [29]. Patients were enrolledwhen the serum creatinine reached approximately 8 mg/dl and were dialyzed to maintain a predialysis ... flow, the dose of therapy can be quantified in terms of the sum of the ultrafiltrate and dialysate flow rates. Ronco and colleagues [9] randomized 425 critically ill patients with AKItreated using...
  • 6
  • 322
  • 0
Báo cáo y học:

Báo cáo y học: "Long-term outcome and prognosis of dissociative disorder with onset in childhood or adolescence" pot

... the study, performed parts of the statistical analysis and drafted the manuscript. SS–S and TW participated in the design, organization and data collection of the study and performed the statistical ... statistical analysis. AW, CW, HE, and WSparticipated in the design and coordination of the study and helped to draft the manuscript. All authors read and approved the final manuscript.AcknowledgementsSpecial ... assessment of data by chart review,which included medical, social and family history, clinicalsymptomatology and the course of dissociative disorder,psychopathology, therapy and outcome. A diagnosisaccording...
  • 10
  • 243
  • 0
Báo cáo y học:

Báo cáo y học: "ome-wide prediction and identification of cis-natural antisense transcripts in Arabidopsis thaliana" pot

... set in the following analysis (Figure 1a) .For most NAT pairs in the second category of the cDNA-NATset, only one transcript in each pair matched an annotatedgene. This indicates that transcripts ... pairsbased on the annotation of their corresponding genes, and 201 genomic-cDNA-NAT pairs, each including a transcriptderived from an annotated gene on one strand and a transcript represented in the full-length ... natural antisense transcripts (NATs) in Arabidopsis identified 1,340 potential NAT pairs. The expression of both sense and antisense transcripts of 957 NAT pairs was confirmed, and analysis of...
  • 11
  • 254
  • 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

... (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), 4 ( CAACGTCATAGACGATTACATTG CTACATGGAGCTGTCTAGAGGATCCGA). A three-strandjunction was made by o mitting strand 4 and a 37-bp duplexDNA by annealing ... labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT),2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), ... junctions. SPR analysis alsoshows that the EcRuvA and MpRuvA bind to the DNAwith fast association rate c onstants (k a ). This results in mathematical mo dels that poorly fit the data, and calcula-tions...
  • 9
  • 542
  • 0
báo cáo hóa học:

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

... forward and back-translation was thenproduced and a final review conducted by the study team. The piloting revealed that all the questions wereanswered, and there was a good distribution of answersfrom ... required. Supervision and qual-ity control were provided by the 3 members of the studyteam and 2 team leaders.Statistical analysisData quality was assessed by analysing the number of incomplete responses ... and disability in postwar Afghanistan. JAMA 2004, 292(5):575-584.7. Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health,social functioning, and attitudes of Kosovar Albanians follow-ing...
  • 10
  • 647
  • 0
báo cáo hóa học:

báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot

... = 12 years) in Poland to 63(STD = 10 years) in Australia. Patients in Poland, SouthAfrica and the United Kingdom were slightly youngerthan in Australia, Germany and Hungary.Mean sleep interference ... impairment [15]. The present study examines perceptions of sleep in an international clinical trial aimed at evaluating the efficacy and safety of the pregabalin, a treatment for pain relief in patients ... completed).Statistical analyses were performed on the overall popula-tion and for the five countries of the study separately.Main analyses were performed using SAS software (Statis-tical Analysis System,...
  • 12
  • 553
  • 0
Báo cáo y học:

Báo cáo y học: "Residual sleep disturbance and risk of relapse during the continuation/maintenance phase treatment of major depressive disorder with the selective serotonin reuptake inhibitor fluoxetine" docx

... distribution, and reproductio n in any medium, provided the original work is properly ci ted.researchers and clinicians have advocated the impor-tance of treating residual symptoms and of exploringtheir ... 10.9), and 55.3% were female. Their mean HDRS score was17.1 (SD = 4.1) at baseline and 4.9 (SD = 3.1) at rando-mization; 22.7% of them had a history of dysthymia and thus curren tly had ‘double depression ... measure The Hamilton Depression Rating Scale (HDRS) [31]administered during the randomization visit (baselinevisit of the continuation and maintenance phase of the study) was used to assess residual...
  • 5
  • 357
  • 0
Báo cáo y học:

Báo cáo y học: "Abnormal costimulatory phenotype and function of dendritic cells before and after the onset of severe murine lupus" pot

... the ELISA anti-DNA and analyzed the data. RC participated in the design of the study and helped to draft the manuscript. SG conceived of the study, and participated in its design and coordination, ... phenotype, analyzed the data, and drafted the manuscript.JD performed many of the immunostainings to characterizeDC phenotype and analyzed the data. DKS monitored the dis-ease in mice with ... production of cytokines, and increased T cell stimulatory capacity before and after the onset of the disease [14]. In our study we analyzed DCs in the original NZM2410 and NZB-W/F1 mice before and after...
  • 11
  • 439
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenreliability and validity of measurementreliability and validity of recruitment testbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo thành tích tập thể ngành y tếBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI